Incidental Mutation 'R5810:Igdcc4'
ID447473
Institutional Source Beutler Lab
Gene Symbol Igdcc4
Ensembl Gene ENSMUSG00000032816
Gene Nameimmunoglobulin superfamily, DCC subclass, member 4
SynonymsWI-18508, WI-16786, Nope, 9330155G14Rik
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65101486-65137940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65128695 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 751 (T751A)
Ref Sequence ENSEMBL: ENSMUSP00000076878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035499] [ENSMUST00000077696] [ENSMUST00000166273] [ENSMUST00000213533]
Predicted Effect probably damaging
Transcript: ENSMUST00000035499
AA Change: T705A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045387
Gene: ENSMUSG00000032816
AA Change: T705A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 40 139 5e0 SMART
IGc2 154 218 1.3e-11 SMART
IGc2 255 318 1.13e-11 SMART
low complexity region 322 335 N/A INTRINSIC
IGc2 346 411 1.34e-13 SMART
FN3 428 511 3.58e-12 SMART
FN3 526 610 9.54e-8 SMART
FN3 630 726 7.34e-9 SMART
FN3 750 832 1.05e-9 SMART
FN3 848 932 2.14e-10 SMART
low complexity region 958 978 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
low complexity region 1154 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077696
AA Change: T751A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076878
Gene: ENSMUSG00000032816
AA Change: T751A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 40 139 5e0 SMART
IGc2 154 218 1.3e-11 SMART
IGc2 255 458 7.02e-8 SMART
FN3 475 558 3.58e-12 SMART
FN3 573 656 1.1e-7 SMART
FN3 676 772 7.34e-9 SMART
FN3 796 878 1.05e-9 SMART
FN3 894 978 2.14e-10 SMART
low complexity region 1004 1024 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
low complexity region 1200 1214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166273
SMART Domains Protein: ENSMUSP00000132576
Gene: ENSMUSG00000032816

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IG 40 83 3e-22 BLAST
low complexity region 142 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213423
Predicted Effect probably damaging
Transcript: ENSMUST00000213533
AA Change: T704A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214978
Meta Mutation Damage Score 0.6709 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Igdcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Igdcc4 APN 9 65135164 missense probably damaging 1.00
IGL01285:Igdcc4 APN 9 65123991 missense probably damaging 1.00
IGL01412:Igdcc4 APN 9 65114449 splice site probably benign
IGL01485:Igdcc4 APN 9 65122607 missense probably benign 0.02
IGL01552:Igdcc4 APN 9 65122502 intron probably benign
IGL01651:Igdcc4 APN 9 65124112 missense possibly damaging 0.63
IGL01751:Igdcc4 APN 9 65131732 missense probably damaging 1.00
IGL02164:Igdcc4 APN 9 65124782 splice site probably benign
IGL02468:Igdcc4 APN 9 65126832 missense probably damaging 1.00
IGL02616:Igdcc4 APN 9 65133078 missense probably damaging 1.00
IGL02685:Igdcc4 APN 9 65133825 missense possibly damaging 0.81
IGL02734:Igdcc4 APN 9 65131456 missense possibly damaging 0.47
IGL02893:Igdcc4 APN 9 65133071 missense probably damaging 1.00
R0006:Igdcc4 UTSW 9 65135100 splice site probably benign
R0583:Igdcc4 UTSW 9 65121813 missense possibly damaging 0.85
R0939:Igdcc4 UTSW 9 65131473 critical splice donor site probably null
R1075:Igdcc4 UTSW 9 65131650 missense possibly damaging 0.90
R1110:Igdcc4 UTSW 9 65126926 missense possibly damaging 0.91
R1183:Igdcc4 UTSW 9 65121900 missense possibly damaging 0.91
R1318:Igdcc4 UTSW 9 65133690 missense probably damaging 1.00
R1507:Igdcc4 UTSW 9 65133744 missense probably damaging 1.00
R1548:Igdcc4 UTSW 9 65135227 missense probably benign 0.08
R1640:Igdcc4 UTSW 9 65122795 missense probably damaging 1.00
R1681:Igdcc4 UTSW 9 65128795 missense probably damaging 1.00
R1687:Igdcc4 UTSW 9 65131663 missense probably damaging 1.00
R1716:Igdcc4 UTSW 9 65126897 missense probably damaging 1.00
R1964:Igdcc4 UTSW 9 65122769 missense probably benign
R1996:Igdcc4 UTSW 9 65121819 missense probably damaging 1.00
R2150:Igdcc4 UTSW 9 65125335 missense possibly damaging 0.92
R2278:Igdcc4 UTSW 9 65130743 missense probably damaging 1.00
R3085:Igdcc4 UTSW 9 65132058 missense probably damaging 1.00
R4011:Igdcc4 UTSW 9 65135479 missense probably benign
R4077:Igdcc4 UTSW 9 65131765 missense probably damaging 1.00
R4191:Igdcc4 UTSW 9 65124151 missense probably benign 0.13
R4293:Igdcc4 UTSW 9 65124610 critical splice acceptor site probably null
R4589:Igdcc4 UTSW 9 65130628 missense probably damaging 1.00
R4931:Igdcc4 UTSW 9 65124015 missense possibly damaging 0.66
R5093:Igdcc4 UTSW 9 65122757 missense possibly damaging 0.51
R5106:Igdcc4 UTSW 9 65124701 missense probably damaging 1.00
R5546:Igdcc4 UTSW 9 65128795 missense probably damaging 1.00
R5634:Igdcc4 UTSW 9 65134546 missense probably benign 0.18
R6395:Igdcc4 UTSW 9 65135118 missense probably damaging 1.00
R6475:Igdcc4 UTSW 9 65120321 missense probably damaging 1.00
R6776:Igdcc4 UTSW 9 65135418 missense probably benign 0.02
R6828:Igdcc4 UTSW 9 65122697 missense probably benign
R6914:Igdcc4 UTSW 9 65120268 missense probably benign 0.00
R6942:Igdcc4 UTSW 9 65120268 missense probably benign 0.00
R7072:Igdcc4 UTSW 9 65130731 missense probably damaging 1.00
R7234:Igdcc4 UTSW 9 65135468 nonsense probably null
R7448:Igdcc4 UTSW 9 65123994 missense possibly damaging 0.52
R7562:Igdcc4 UTSW 9 65124024 missense probably damaging 1.00
R7607:Igdcc4 UTSW 9 65133758 missense possibly damaging 0.85
R7734:Igdcc4 UTSW 9 65131753 missense probably damaging 0.99
R7807:Igdcc4 UTSW 9 65133795 missense probably benign 0.00
R7852:Igdcc4 UTSW 9 65120258 missense probably benign 0.04
R7904:Igdcc4 UTSW 9 65134519 missense probably benign 0.00
R8133:Igdcc4 UTSW 9 65131741 missense possibly damaging 0.54
R8147:Igdcc4 UTSW 9 65123971 missense probably benign 0.42
R8230:Igdcc4 UTSW 9 65122738 missense probably damaging 1.00
R8822:Igdcc4 UTSW 9 65124016 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AAAGATGGAGTCCCTGGTGG -3'
(R):5'- CGGCTTGCTGGCTGATAAAG -3'

Sequencing Primer
(F):5'- TGGTGTCATGGCAGCCG -3'
(R):5'- GCTTGCTGGCTGATAAAGAAAAAG -3'
Posted On2016-12-15