Incidental Mutation 'R5810:Dyrk2'
ID447476
Institutional Source Beutler Lab
Gene Symbol Dyrk2
Ensembl Gene ENSMUSG00000028630
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Synonyms1810038L18Rik
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.467) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location118855603-118870209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118860340 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 338 (H338N)
Ref Sequence ENSEMBL: ENSMUSP00000004281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004281]
Predicted Effect probably benign
Transcript: ENSMUST00000004281
AA Change: H338N

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000004281
Gene: ENSMUSG00000028630
AA Change: H338N

DomainStartEndE-ValueType
S_TKc 220 533 1.16e-92 SMART
low complexity region 560 574 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218692
Meta Mutation Damage Score 0.4373 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Dyrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dyrk2 APN 10 118859844 missense probably damaging 1.00
IGL00536:Dyrk2 APN 10 118860192 missense probably damaging 1.00
IGL01288:Dyrk2 APN 10 118860699 missense probably damaging 1.00
IGL01375:Dyrk2 APN 10 118860687 missense probably damaging 1.00
IGL01637:Dyrk2 APN 10 118860507 missense probably damaging 1.00
IGL02052:Dyrk2 APN 10 118860543 missense probably damaging 1.00
R0452:Dyrk2 UTSW 10 118868763 missense possibly damaging 0.91
R0833:Dyrk2 UTSW 10 118861122 missense probably benign 0.00
R0836:Dyrk2 UTSW 10 118861122 missense probably benign 0.00
R1346:Dyrk2 UTSW 10 118859719 missense possibly damaging 0.92
R1610:Dyrk2 UTSW 10 118859925 missense probably benign 0.02
R2397:Dyrk2 UTSW 10 118861368 intron probably benign
R2409:Dyrk2 UTSW 10 118860627 missense probably benign
R2965:Dyrk2 UTSW 10 118860337 nonsense probably null
R2966:Dyrk2 UTSW 10 118860337 nonsense probably null
R4700:Dyrk2 UTSW 10 118868286 missense probably benign
R4896:Dyrk2 UTSW 10 118868248 missense probably damaging 0.96
R4978:Dyrk2 UTSW 10 118860347 missense probably benign 0.00
R5393:Dyrk2 UTSW 10 118859848 missense probably damaging 0.98
R5442:Dyrk2 UTSW 10 118860738 missense possibly damaging 0.72
R5496:Dyrk2 UTSW 10 118860051 missense probably damaging 1.00
R5875:Dyrk2 UTSW 10 118860697 missense probably damaging 1.00
R5930:Dyrk2 UTSW 10 118860268 missense probably damaging 1.00
R6877:Dyrk2 UTSW 10 118860423 missense probably damaging 1.00
R7234:Dyrk2 UTSW 10 118860231 missense possibly damaging 0.84
R7442:Dyrk2 UTSW 10 118859881 missense probably damaging 1.00
R7741:Dyrk2 UTSW 10 118859689 missense probably benign
R8108:Dyrk2 UTSW 10 118859829 missense probably benign 0.27
R8137:Dyrk2 UTSW 10 118859884 missense probably benign 0.00
R8347:Dyrk2 UTSW 10 118859983 missense probably damaging 0.99
R8507:Dyrk2 UTSW 10 118860662 missense probably damaging 1.00
R8517:Dyrk2 UTSW 10 118861021 missense probably benign
R8695:Dyrk2 UTSW 10 118861017 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGGGCATGCCATACCTGG -3'
(R):5'- TTGGAACACCTACGGAAGC -3'

Sequencing Primer
(F):5'- ATACCTGGCTCCGAGGATCAC -3'
(R):5'- GGACAACACTATGAACGTCATC -3'
Posted On2016-12-15