Incidental Mutation 'R5810:Gli3'
ID 447479
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms Bph, brachyphalangy
MMRRC Submission 043395-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5810 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 15638308-15904611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15818894 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 232 (V232A)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510] [ENSMUST00000130065] [ENSMUST00000141194]
AlphaFold Q61602
Predicted Effect probably damaging
Transcript: ENSMUST00000110510
AA Change: V232A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: V232A

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130065
AA Change: V232A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115989
Gene: ENSMUSG00000021318
AA Change: V232A

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 596 1.45e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130535
Predicted Effect probably benign
Transcript: ENSMUST00000141194
Meta Mutation Damage Score 0.0847 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 (GRCm39) F866L probably benign Het
Abca16 T A 7: 120,035,155 (GRCm39) C314S probably damaging Het
Actl11 C T 9: 107,806,420 (GRCm39) P248S probably benign Het
Actr3 A G 1: 125,344,116 (GRCm39) probably benign Het
Baz1a G A 12: 54,974,500 (GRCm39) probably benign Het
Birc6 A C 17: 74,977,369 (GRCm39) N4388T probably damaging Het
Bpifa5 G A 2: 154,005,638 (GRCm39) probably null Het
Car13 A C 3: 14,706,828 (GRCm39) probably null Het
Ceacam18 A T 7: 43,286,382 (GRCm39) H85L probably benign Het
Cnnm3 A G 1: 36,564,280 (GRCm39) E704G probably benign Het
Cyp4f14 T A 17: 33,125,072 (GRCm39) I450F possibly damaging Het
Ddhd1 G T 14: 45,840,164 (GRCm39) T710N probably damaging Het
Ddx60 C T 8: 62,465,422 (GRCm39) Q1360* probably null Het
Dlg5 A G 14: 24,196,322 (GRCm39) V1625A probably damaging Het
Dst G A 1: 34,222,121 (GRCm39) probably benign Het
Dyrk2 G T 10: 118,696,245 (GRCm39) H338N probably benign Het
Epb41l1 A T 2: 156,341,575 (GRCm39) I187F probably damaging Het
Esd A G 14: 74,983,051 (GRCm39) D221G probably damaging Het
Fam53b T A 7: 132,361,893 (GRCm39) N45I probably damaging Het
Fchsd1 C T 18: 38,092,926 (GRCm39) probably benign Het
Fryl A T 5: 73,248,098 (GRCm39) D1006E probably benign Het
Gm28308 C A 6: 52,190,196 (GRCm39) probably benign Het
Gpatch1 G A 7: 34,994,796 (GRCm39) A490V probably benign Het
Hoxa7 T C 6: 52,193,004 (GRCm39) D128G probably benign Het
Igdcc4 A G 9: 65,035,977 (GRCm39) T751A probably damaging Het
Igsf10 G A 3: 59,226,492 (GRCm39) L2394F probably damaging Het
Il15ra A G 2: 11,738,063 (GRCm39) probably null Het
Il17re C T 6: 113,446,557 (GRCm39) A436V probably damaging Het
Krtap19-2 T C 16: 88,671,124 (GRCm39) probably benign Het
Larp7-ps A T 4: 92,079,820 (GRCm39) probably null Het
Lgals12 T C 19: 7,584,085 (GRCm39) D4G probably benign Het
Liph A T 16: 21,786,860 (GRCm39) L252Q probably damaging Het
Mtg1 T A 7: 139,725,898 (GRCm39) probably null Het
Myo18b A G 5: 112,982,316 (GRCm39) L1139P probably damaging Het
Ninl T C 2: 150,792,088 (GRCm39) R812G probably benign Het
Npm3 A G 19: 45,736,644 (GRCm39) I165T possibly damaging Het
Or1e22 G T 11: 73,376,921 (GRCm39) S243* probably null Het
Osbpl9 A G 4: 108,943,571 (GRCm39) V231A probably benign Het
Pgam2 T C 11: 5,753,417 (GRCm39) H91R possibly damaging Het
Pkhd1 A G 1: 20,270,897 (GRCm39) W3219R probably benign Het
Procr A G 2: 155,593,327 (GRCm39) K4E possibly damaging Het
Slc22a16 C T 10: 40,471,314 (GRCm39) T495I possibly damaging Het
Slc22a6 A G 19: 8,601,222 (GRCm39) K425E probably damaging Het
Slco6c1 A T 1: 97,003,598 (GRCm39) C500S probably damaging Het
Snrpd2 G T 7: 18,886,447 (GRCm39) V77F probably benign Het
Sp100 G A 1: 85,593,006 (GRCm39) G145D probably benign Het
Spg7 G A 8: 123,821,308 (GRCm39) E678K possibly damaging Het
Ssh1 T C 5: 114,084,627 (GRCm39) K538E probably benign Het
Sspo C T 6: 48,460,832 (GRCm39) R3356W probably benign Het
Stx1a G T 5: 135,077,932 (GRCm39) V255F probably damaging Het
Tbc1d13 C A 2: 30,032,380 (GRCm39) Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,264,768 (GRCm39) probably benign Het
Tpm2 T C 4: 43,518,968 (GRCm39) probably benign Het
Triobp T C 15: 78,852,467 (GRCm39) C874R probably benign Het
Tymp T A 15: 89,258,534 (GRCm39) H269L probably damaging Het
Vmn1r194 T A 13: 22,428,597 (GRCm39) Y71* probably null Het
Vmn2r102 T C 17: 19,897,804 (GRCm39) V273A probably benign Het
Vmn2r2 A T 3: 64,024,815 (GRCm39) C589S probably damaging Het
Vps13a T C 19: 16,643,688 (GRCm39) T2063A probably benign Het
Ywhaz T C 15: 36,775,510 (GRCm39) I217M probably damaging Het
Zfp322a A C 13: 23,541,579 (GRCm39) Y54* probably null Het
Zswim9 A T 7: 12,994,662 (GRCm39) V498D probably damaging Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15,818,884 (GRCm39) missense probably damaging 1.00
IGL00471:Gli3 APN 13 15,898,354 (GRCm39) critical splice donor site probably null
IGL00484:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15,722,983 (GRCm39) critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15,823,219 (GRCm39) missense probably damaging 1.00
IGL01799:Gli3 APN 13 15,900,746 (GRCm39) missense probably benign 0.00
IGL01861:Gli3 APN 13 15,899,910 (GRCm39) missense probably damaging 1.00
IGL02063:Gli3 APN 13 15,900,957 (GRCm39) missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15,837,099 (GRCm39) missense probably damaging 1.00
IGL02255:Gli3 APN 13 15,823,304 (GRCm39) missense probably damaging 1.00
IGL02270:Gli3 APN 13 15,901,371 (GRCm39) utr 3 prime probably benign
IGL02336:Gli3 APN 13 15,894,874 (GRCm39) missense probably damaging 1.00
IGL02346:Gli3 APN 13 15,898,278 (GRCm39) missense probably damaging 1.00
IGL02744:Gli3 APN 13 15,788,471 (GRCm39) critical splice donor site probably null
IGL02877:Gli3 APN 13 15,899,327 (GRCm39) missense probably damaging 1.00
IGL02975:Gli3 APN 13 15,899,153 (GRCm39) missense probably damaging 1.00
IGL03018:Gli3 APN 13 15,834,717 (GRCm39) missense probably damaging 1.00
IGL03378:Gli3 APN 13 15,819,005 (GRCm39) missense probably damaging 1.00
IGL03406:Gli3 APN 13 15,823,166 (GRCm39) missense probably damaging 1.00
Capone UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
Carpals UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
Ness UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15,818,942 (GRCm39) missense probably damaging 1.00
R0110:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0329:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0330:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0360:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0364:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0469:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0616:Gli3 UTSW 13 15,836,991 (GRCm39) missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15,899,300 (GRCm39) missense probably damaging 1.00
R1072:Gli3 UTSW 13 15,888,190 (GRCm39) missense probably damaging 1.00
R1257:Gli3 UTSW 13 15,900,581 (GRCm39) nonsense probably null
R1270:Gli3 UTSW 13 15,898,329 (GRCm39) missense probably benign 0.02
R1424:Gli3 UTSW 13 15,900,899 (GRCm39) missense probably benign 0.00
R1481:Gli3 UTSW 13 15,788,435 (GRCm39) missense probably damaging 0.99
R1596:Gli3 UTSW 13 15,900,056 (GRCm39) missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15,900,897 (GRCm39) missense probably benign 0.00
R1721:Gli3 UTSW 13 15,900,882 (GRCm39) missense probably benign 0.27
R1797:Gli3 UTSW 13 15,888,097 (GRCm39) missense probably damaging 0.99
R1813:Gli3 UTSW 13 15,823,276 (GRCm39) missense probably damaging 1.00
R1819:Gli3 UTSW 13 15,900,377 (GRCm39) nonsense probably null
R1988:Gli3 UTSW 13 15,900,965 (GRCm39) missense probably benign
R2132:Gli3 UTSW 13 15,900,134 (GRCm39) missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15,836,977 (GRCm39) missense probably benign 0.02
R3085:Gli3 UTSW 13 15,835,526 (GRCm39) missense probably damaging 1.00
R3177:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R3277:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R4162:Gli3 UTSW 13 15,899,700 (GRCm39) missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15,898,156 (GRCm39) missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15,888,216 (GRCm39) missense probably damaging 1.00
R4979:Gli3 UTSW 13 15,899,049 (GRCm39) missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15,723,092 (GRCm39) missense probably damaging 0.99
R5395:Gli3 UTSW 13 15,889,535 (GRCm39) missense probably damaging 1.00
R5494:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R5609:Gli3 UTSW 13 15,723,038 (GRCm39) missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15,652,750 (GRCm39) critical splice donor site probably null
R5896:Gli3 UTSW 13 15,900,765 (GRCm39) missense probably benign 0.00
R5930:Gli3 UTSW 13 15,723,210 (GRCm39) missense probably damaging 1.00
R5964:Gli3 UTSW 13 15,900,747 (GRCm39) nonsense probably null
R5985:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6224:Gli3 UTSW 13 15,899,730 (GRCm39) missense probably benign
R6278:Gli3 UTSW 13 15,899,698 (GRCm39) missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15,899,317 (GRCm39) missense probably damaging 1.00
R6383:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6523:Gli3 UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
R7072:Gli3 UTSW 13 15,900,280 (GRCm39) missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15,889,647 (GRCm39) missense probably damaging 1.00
R7228:Gli3 UTSW 13 15,899,087 (GRCm39) missense probably benign 0.00
R7327:Gli3 UTSW 13 15,900,144 (GRCm39) missense probably benign 0.02
R7451:Gli3 UTSW 13 15,900,876 (GRCm39) missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15,900,841 (GRCm39) missense probably benign 0.00
R8167:Gli3 UTSW 13 15,900,228 (GRCm39) missense probably benign 0.00
R8170:Gli3 UTSW 13 15,894,793 (GRCm39) missense probably benign
R8199:Gli3 UTSW 13 15,900,576 (GRCm39) missense probably benign 0.08
R8247:Gli3 UTSW 13 15,901,360 (GRCm39) missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15,888,133 (GRCm39) missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15,898,110 (GRCm39) missense probably damaging 1.00
R8559:Gli3 UTSW 13 15,834,717 (GRCm39) missense probably damaging 1.00
R8676:Gli3 UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
R8905:Gli3 UTSW 13 15,901,116 (GRCm39) missense probably benign 0.01
R9099:Gli3 UTSW 13 15,901,320 (GRCm39) missense probably damaging 1.00
R9260:Gli3 UTSW 13 15,899,675 (GRCm39) missense probably damaging 0.99
R9317:Gli3 UTSW 13 15,889,658 (GRCm39) missense probably damaging 1.00
R9475:Gli3 UTSW 13 15,900,296 (GRCm39) missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15,788,443 (GRCm39) missense probably benign 0.00
R9571:Gli3 UTSW 13 15,900,858 (GRCm39) missense probably benign 0.00
R9621:Gli3 UTSW 13 15,901,253 (GRCm39) missense probably benign 0.01
R9704:Gli3 UTSW 13 15,898,058 (GRCm39) missense probably damaging 1.00
R9787:Gli3 UTSW 13 15,900,386 (GRCm39) missense probably damaging 0.96
RF010:Gli3 UTSW 13 15,900,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTCCAGATAAAGACATGATGC -3'
(R):5'- GCTTAACCTTTGCAGCTTGC -3'

Sequencing Primer
(F):5'- CAAATGAATGCATACGTAGAACAGC -3'
(R):5'- AACCTTTGCAGCTTGCTCTCC -3'
Posted On 2016-12-15