Incidental Mutation 'R0545:Lrrc38'
ID 44748
Institutional Source Beutler Lab
Gene Symbol Lrrc38
Ensembl Gene ENSMUSG00000028584
Gene Name leucine rich repeat containing 38
Synonyms A230053A07Rik
MMRRC Submission 038737-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R0545 (G1)
Quality Score 185
Status Validated
Chromosome 4
Chromosomal Location 143076327-143097602 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 143077328 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 197 (D197G)
Ref Sequence ENSEMBL: ENSMUSP00000053597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052458]
AlphaFold A2VDH3
Predicted Effect probably benign
Transcript: ENSMUST00000052458
AA Change: D197G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053597
Gene: ENSMUSG00000028584
AA Change: D197G

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
LRRNT 31 64 2.82e-4 SMART
LRR 84 106 1.37e1 SMART
LRR 108 130 5.26e0 SMART
LRR 132 154 2.27e1 SMART
LRR 155 178 8.09e-1 SMART
LRRCT 190 244 8.63e-6 SMART
transmembrane domain 252 274 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Meta Mutation Damage Score 0.0771 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,547,187 (GRCm39) R76H probably damaging Het
Adnp2 T C 18: 80,172,616 (GRCm39) I598V probably benign Het
Ago3 T C 4: 126,311,025 (GRCm39) N63D probably damaging Het
Alkbh7 C T 17: 57,306,012 (GRCm39) R138* probably null Het
Atp6ap1l T C 13: 91,031,782 (GRCm39) H300R probably benign Het
BC051076 C T 5: 88,111,349 (GRCm39) noncoding transcript Het
Bltp1 G A 3: 37,041,839 (GRCm39) probably benign Het
Bpifb9a T A 2: 154,103,870 (GRCm39) C104* probably null Het
Cacna2d2 T C 9: 107,402,422 (GRCm39) L826P probably damaging Het
Car5b G A X: 162,762,297 (GRCm39) R282C probably damaging Het
Ccdc88c T C 12: 100,913,447 (GRCm39) D526G probably damaging Het
Cdh23 T A 10: 60,167,070 (GRCm39) T1861S probably benign Het
Ces2f A C 8: 105,676,668 (GRCm39) M121L possibly damaging Het
Cfap58 G A 19: 47,929,536 (GRCm39) probably benign Het
Chpf2 T C 5: 24,795,322 (GRCm39) S282P possibly damaging Het
Cluap1 C T 16: 3,751,636 (GRCm39) R332W probably damaging Het
Cma2 A T 14: 56,210,570 (GRCm39) M86L probably benign Het
Cog6 A T 3: 52,903,496 (GRCm39) M134K probably damaging Het
Col1a1 A G 11: 94,842,420 (GRCm39) D1446G unknown Het
Cpne8 T A 15: 90,381,278 (GRCm39) D512V probably damaging Het
Ctnna2 T A 6: 77,582,165 (GRCm39) N352I probably damaging Het
Cyp2c69 A C 19: 39,875,105 (GRCm39) L16R probably damaging Het
Dysf T C 6: 84,076,443 (GRCm39) S603P probably damaging Het
Epha5 A G 5: 84,215,217 (GRCm39) probably null Het
Ercc3 T C 18: 32,378,955 (GRCm39) S270P probably damaging Het
F10 T A 8: 13,098,249 (GRCm39) C151S probably damaging Het
Gpr180 T G 14: 118,397,458 (GRCm39) H317Q possibly damaging Het
Gstp2 T C 19: 4,091,633 (GRCm39) E32G possibly damaging Het
Ikzf5 T C 7: 130,994,229 (GRCm39) T133A possibly damaging Het
Itch G T 2: 155,024,218 (GRCm39) G274* probably null Het
Jarid2 T A 13: 45,056,307 (GRCm39) N365K probably benign Het
Lama3 T A 18: 12,694,758 (GRCm39) S1295T possibly damaging Het
Lipc A G 9: 70,719,987 (GRCm39) L255P probably damaging Het
Mfap2 A G 4: 140,741,496 (GRCm39) probably benign Het
Mfhas1 A G 8: 36,056,202 (GRCm39) K226E probably damaging Het
Morc1 A G 16: 48,386,020 (GRCm39) R548G probably benign Het
Mrgprb5 T C 7: 47,818,633 (GRCm39) N34S probably benign Het
Mroh4 T C 15: 74,497,276 (GRCm39) T182A probably benign Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Myo5a T C 9: 75,074,319 (GRCm39) F743L possibly damaging Het
Notch4 A C 17: 34,802,407 (GRCm39) D1276A probably damaging Het
Or1e34 A T 11: 73,778,843 (GRCm39) Y118* probably null Het
Or3a10 A G 11: 73,935,873 (GRCm39) C76R possibly damaging Het
Or6c209 T A 10: 129,483,218 (GRCm39) C74S probably damaging Het
Or6d15 T A 6: 116,559,617 (GRCm39) I97L probably benign Het
Plin4 T A 17: 56,413,567 (GRCm39) T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 (GRCm39) T827A probably benign Het
Prlr C T 15: 10,317,652 (GRCm39) T40I probably damaging Het
Psme3 T C 11: 101,210,730 (GRCm39) probably benign Het
Pygb A T 2: 150,657,626 (GRCm39) D363V probably benign Het
Rsph6a C T 7: 18,788,871 (GRCm39) Q68* probably null Het
Serpini2 A G 3: 75,165,445 (GRCm39) V178A probably benign Het
Sh2d2a T C 3: 87,759,195 (GRCm39) probably benign Het
Skint7 A C 4: 111,837,395 (GRCm39) M58L probably benign Het
Slco3a1 G T 7: 73,970,301 (GRCm39) Y435* probably null Het
Stk17b T C 1: 53,801,742 (GRCm39) probably benign Het
Tinag T A 9: 76,938,992 (GRCm39) H162L possibly damaging Het
Ttc21a T A 9: 119,787,865 (GRCm39) L811Q probably damaging Het
Ttc41 A T 10: 86,594,961 (GRCm39) M912L probably benign Het
Vmn2r98 G T 17: 19,273,875 (GRCm39) V41F probably benign Het
Washc5 C T 15: 59,213,942 (GRCm39) C838Y possibly damaging Het
Wrnip1 A G 13: 32,990,796 (GRCm39) T352A probably damaging Het
Zan A C 5: 137,394,439 (GRCm39) C4467G unknown Het
Zc3h7a T C 16: 10,970,197 (GRCm39) probably benign Het
Zfp729a C A 13: 67,768,345 (GRCm39) C628F probably benign Het
Other mutations in Lrrc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0281:Lrrc38 UTSW 4 143,076,979 (GRCm39) missense probably damaging 0.99
R1078:Lrrc38 UTSW 4 143,077,088 (GRCm39) missense probably benign 0.06
R1467:Lrrc38 UTSW 4 143,096,450 (GRCm39) missense probably damaging 1.00
R1467:Lrrc38 UTSW 4 143,096,450 (GRCm39) missense probably damaging 1.00
R1967:Lrrc38 UTSW 4 143,096,553 (GRCm39) missense unknown
R2221:Lrrc38 UTSW 4 143,096,419 (GRCm39) nonsense probably null
R2223:Lrrc38 UTSW 4 143,096,419 (GRCm39) nonsense probably null
R4061:Lrrc38 UTSW 4 143,077,076 (GRCm39) missense probably damaging 1.00
R4930:Lrrc38 UTSW 4 143,096,438 (GRCm39) missense probably damaging 0.98
R5585:Lrrc38 UTSW 4 143,076,961 (GRCm39) missense probably damaging 0.96
R6787:Lrrc38 UTSW 4 143,096,364 (GRCm39) missense probably benign 0.18
R7046:Lrrc38 UTSW 4 143,076,739 (GRCm39) start codon destroyed probably null
R7706:Lrrc38 UTSW 4 143,076,845 (GRCm39) missense probably damaging 1.00
R8189:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8190:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8192:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8219:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8221:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8223:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8226:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTTCTGGACCTGAGCTACAAC -3'
(R):5'- ACTTTCTGGTGAGCCCCAAAACG -3'

Sequencing Primer
(F):5'- CTGGTCAAGCTGAGCCTG -3'
(R):5'- GCTCACCTTTGGGCAATTTG -3'
Posted On 2013-06-11