Incidental Mutation 'R5810:Ddhd1'
ID447483
Institutional Source Beutler Lab
Gene Symbol Ddhd1
Ensembl Gene ENSMUSG00000037697
Gene NameDDHD domain containing 1
Synonyms9630061G18Rik, 4921528E07Rik
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location45588467-45658143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45602707 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 710 (T710N)
Ref Sequence ENSEMBL: ENSMUSP00000107459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051310] [ENSMUST00000087320] [ENSMUST00000111828] [ENSMUST00000149286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051310
AA Change: T710N

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050088
Gene: ENSMUSG00000037697
AA Change: T710N

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 6e-67 BLAST
DDHD 595 842 1.49e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087320
AA Change: T744N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084577
Gene: ENSMUSG00000037697
AA Change: T744N

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 484 607 1e-66 BLAST
DDHD 629 904 3.75e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111828
AA Change: T710N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107459
Gene: ENSMUSG00000037697
AA Change: T710N

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 8e-67 BLAST
DDHD 595 870 3.75e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129599
Predicted Effect probably benign
Transcript: ENSMUST00000141487
SMART Domains Protein: ENSMUSP00000133358
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
Blast:DDHD 111 149 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149286
SMART Domains Protein: ENSMUSP00000118848
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152110
Predicted Effect unknown
Transcript: ENSMUST00000156758
AA Change: T7N
SMART Domains Protein: ENSMUSP00000121837
Gene: ENSMUSG00000037697
AA Change: T7N

DomainStartEndE-ValueType
DDHD 1 168 3.8e-11 SMART
Meta Mutation Damage Score 0.1398 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the intracellular phospholipase A1 gene family. The protein encoded by this gene preferentially hydrolyzes phosphatidic acid. It is a cytosolic protein with some mitochondrial localization, and is thought to be involved in the regulation of mitochondrial dynamics. Overexpression of this gene causes fragmentation of the tubular structures in mitochondria, while depletion of the gene results in mitochondrial tubule elongation. Deletion of this gene in male mice caused fertility defects, resulting from disruption in the organization of the mitochondria during spermiogenesis. In humans, mutations in this gene have been associated with hereditary spastic paraplegia (HSP), also known as Strumpell-Lorrain disease, or, familial spastic paraparesis (FSP). This inherited disorder is characterized by progressive weakness and spasticity of the legs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele show reduced testis weight, oligozoospermia, teratozoospermia, and male subfertility. Sperm defects include a disorganized mitochondrial structure, an abnormal gap between the middle and principal pieces, and hairpin flagellum leading to impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Ddhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Ddhd1 APN 14 45616551 missense probably damaging 1.00
IGL01635:Ddhd1 APN 14 45629580 missense probably null 0.98
IGL02176:Ddhd1 APN 14 45616600 missense probably damaging 1.00
IGL02698:Ddhd1 APN 14 45605206 unclassified probably benign
IGL03052:Ddhd1 UTSW 14 45620783 missense probably damaging 1.00
PIT4434001:Ddhd1 UTSW 14 45610605 missense possibly damaging 0.62
R0037:Ddhd1 UTSW 14 45610510 missense probably damaging 1.00
R0105:Ddhd1 UTSW 14 45610690 missense probably benign 0.37
R0165:Ddhd1 UTSW 14 45595592 missense probably damaging 1.00
R1237:Ddhd1 UTSW 14 45601650 missense probably benign 0.01
R1401:Ddhd1 UTSW 14 45605051 critical splice donor site probably null
R1574:Ddhd1 UTSW 14 45595547 missense probably damaging 1.00
R1574:Ddhd1 UTSW 14 45595547 missense probably damaging 1.00
R1582:Ddhd1 UTSW 14 45605109 missense probably damaging 0.98
R2070:Ddhd1 UTSW 14 45610624 missense probably damaging 1.00
R2307:Ddhd1 UTSW 14 45608990 missense probably damaging 1.00
R2417:Ddhd1 UTSW 14 45657272 missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45610573 missense probably benign 0.00
R3756:Ddhd1 UTSW 14 45657263 missense probably damaging 1.00
R4541:Ddhd1 UTSW 14 45622856 nonsense probably null
R4737:Ddhd1 UTSW 14 45628821 intron probably benign
R5105:Ddhd1 UTSW 14 45657407 missense probably benign 0.00
R5898:Ddhd1 UTSW 14 45602668 missense probably damaging 1.00
R6217:Ddhd1 UTSW 14 45619514 splice site probably null
R6218:Ddhd1 UTSW 14 45614176 missense probably damaging 1.00
R6671:Ddhd1 UTSW 14 45657232 frame shift probably null
R6787:Ddhd1 UTSW 14 45657519 missense probably benign 0.01
R7049:Ddhd1 UTSW 14 45602681 missense probably damaging 1.00
R7150:Ddhd1 UTSW 14 45657806 missense probably damaging 1.00
R7213:Ddhd1 UTSW 14 45657753 missense probably benign 0.41
R7261:Ddhd1 UTSW 14 45657231 missense probably damaging 1.00
R7522:Ddhd1 UTSW 14 45657647 missense possibly damaging 0.47
R7920:Ddhd1 UTSW 14 45657470 missense probably damaging 0.96
R8736:Ddhd1 UTSW 14 45599185 missense probably benign 0.30
Z1177:Ddhd1 UTSW 14 45657594 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GAGGATGTCAGAGCATCTGC -3'
(R):5'- AGGCCTACAGATTAGAACCGTTG -3'

Sequencing Primer
(F):5'- TTCAGTCAGCAAAGACGCTAATTCAG -3'
(R):5'- CCGTTGATTTTGAAACACTACAGC -3'
Posted On2016-12-15