Incidental Mutation 'R5810:Esd'
ID447484
Institutional Source Beutler Lab
Gene Symbol Esd
Ensembl Gene ENSMUSG00000021996
Gene Nameesterase D/formylglutathione hydrolase
SynonymsEs10, Es-10, Esd
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location74732297-74750765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74745611 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 221 (D221G)
Ref Sequence ENSEMBL: ENSMUSP00000135063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022573] [ENSMUST00000175712] [ENSMUST00000175887] [ENSMUST00000176957] [ENSMUST00000177137] [ENSMUST00000177181] [ENSMUST00000177283]
Predicted Effect probably damaging
Transcript: ENSMUST00000022573
AA Change: D221G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022573
Gene: ENSMUSG00000021996
AA Change: D221G

DomainStartEndE-ValueType
Pfam:Esterase 23 275 8.1e-74 PFAM
Pfam:Chlorophyllase2 29 184 2.7e-8 PFAM
Pfam:Esterase_phd 30 231 1e-7 PFAM
Pfam:Abhydrolase_5 48 261 4.6e-9 PFAM
Pfam:Peptidase_S9 102 282 2.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175712
SMART Domains Protein: ENSMUSP00000134932
Gene: ENSMUSG00000021996

DomainStartEndE-ValueType
Pfam:Esterase 23 131 4.5e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175887
AA Change: D188G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135244
Gene: ENSMUSG00000021996
AA Change: D188G

DomainStartEndE-ValueType
Pfam:Esterase 23 242 1.3e-57 PFAM
Pfam:Chlorophyllase2 29 186 2.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176188
Predicted Effect probably benign
Transcript: ENSMUST00000176726
Predicted Effect probably damaging
Transcript: ENSMUST00000176957
AA Change: D234G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135394
Gene: ENSMUSG00000021996
AA Change: D234G

DomainStartEndE-ValueType
Pfam:AXE1 26 198 1e-7 PFAM
Pfam:Esterase 36 288 6.6e-74 PFAM
Pfam:Abhydrolase_5 61 274 7.1e-9 PFAM
Pfam:Peptidase_S9 116 295 2.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177137
AA Change: D221G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135818
Gene: ENSMUSG00000021996
AA Change: D221G

DomainStartEndE-ValueType
Pfam:Esterase 23 259 1.4e-68 PFAM
Pfam:Chlorophyllase2 29 184 2.2e-8 PFAM
Pfam:Esterase_phd 30 231 7.9e-8 PFAM
Pfam:Abhydrolase_5 48 247 5.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177181
AA Change: D221G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135035
Gene: ENSMUSG00000021996
AA Change: D221G

DomainStartEndE-ValueType
Pfam:Esterase 23 261 2e-68 PFAM
Pfam:Chlorophyllase2 29 184 2.3e-8 PFAM
Pfam:Esterase_phd 30 231 8.4e-8 PFAM
Pfam:Abhydrolase_5 48 248 5.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177283
AA Change: D221G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135063
Gene: ENSMUSG00000021996
AA Change: D221G

DomainStartEndE-ValueType
Pfam:AXE1 16 185 1.1e-7 PFAM
Pfam:Esterase 23 247 1e-67 PFAM
Pfam:Chlorophyllase2 29 184 1.9e-8 PFAM
Pfam:Esterase_phd 30 231 2.5e-8 PFAM
Pfam:Abhydrolase_5 48 239 5.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177445
Meta Mutation Damage Score 0.9570 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Esd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Esd APN 14 74736027 missense probably damaging 1.00
IGL00534:Esd APN 14 74738461 missense probably damaging 0.99
IGL00904:Esd APN 14 74749688 makesense probably null
IGL01645:Esd APN 14 74749719 missense probably benign 0.00
IGL03117:Esd APN 14 74741246 missense probably damaging 1.00
R0766:Esd UTSW 14 74742121 missense probably damaging 1.00
R0939:Esd UTSW 14 74736027 missense probably damaging 1.00
R1862:Esd UTSW 14 74742074 missense probably damaging 1.00
R1892:Esd UTSW 14 74749673 missense probably damaging 0.96
R3922:Esd UTSW 14 74743227 missense probably benign 0.00
R4580:Esd UTSW 14 74742077 missense possibly damaging 0.55
R4830:Esd UTSW 14 74741160 missense probably damaging 1.00
R4969:Esd UTSW 14 74744713 missense possibly damaging 0.76
R5211:Esd UTSW 14 74741192 missense probably damaging 1.00
R5335:Esd UTSW 14 74742113 missense probably damaging 0.99
R7024:Esd UTSW 14 74744662 missense probably damaging 1.00
R7759:Esd UTSW 14 74745567 nonsense probably null
R8673:Esd UTSW 14 74732512 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CATTCTCTGCTGGTGATTGC -3'
(R):5'- AGGTAAGAGACTTGTACACATCTTGC -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- ACACATCTTGCCTTTAAAGTGTTGC -3'
Posted On2016-12-15