Incidental Mutation 'R5810:Triobp'
ID447486
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78968267 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 874 (C874R)
Ref Sequence ENSEMBL: ENSMUSP00000155397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228]
Predicted Effect probably benign
Transcript: ENSMUST00000109689
AA Change: C874R

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: C874R

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109690
AA Change: C874R

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: C874R

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140228
AA Change: C874R

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
R7688:Triobp UTSW 15 78961111 splice site probably null
R7805:Triobp UTSW 15 78974004 missense probably benign 0.37
R7972:Triobp UTSW 15 78967986 missense probably damaging 1.00
R7977:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7987:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7999:Triobp UTSW 15 78959944 missense probably damaging 0.99
R8344:Triobp UTSW 15 78958275 missense possibly damaging 0.67
R8348:Triobp UTSW 15 78994126 missense possibly damaging 0.85
RF001:Triobp UTSW 15 78967027 small insertion probably benign
RF005:Triobp UTSW 15 78967061 small insertion probably benign
RF007:Triobp UTSW 15 78967044 small insertion probably benign
RF022:Triobp UTSW 15 78974282 missense probably benign 0.05
RF028:Triobp UTSW 15 78967039 small insertion probably benign
RF032:Triobp UTSW 15 78967036 small insertion probably benign
RF035:Triobp UTSW 15 78967039 small insertion probably benign
RF039:Triobp UTSW 15 78967036 small insertion probably benign
RF039:Triobp UTSW 15 78967039 small insertion probably benign
RF040:Triobp UTSW 15 78967063 small insertion probably benign
RF049:Triobp UTSW 15 78967061 small insertion probably benign
RF051:Triobp UTSW 15 78967034 small insertion probably benign
RF058:Triobp UTSW 15 78967044 small insertion probably benign
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Z1177:Triobp UTSW 15 79002181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAATGAGTCCCCGCAGCAC -3'
(R):5'- CAAGTTGTGTCTGGTCTCCC -3'

Sequencing Primer
(F):5'- ACCAGTGTGCATCGGGTAC -3'
(R):5'- TGTCTGGTCTCCCCTGGG -3'
Posted On2016-12-15