Incidental Mutation 'R5810:Fchsd1'
ID447495
Institutional Source Beutler Lab
Gene Symbol Fchsd1
Ensembl Gene ENSMUSG00000038524
Gene NameFCH and double SH3 domains 1
SynonymsA030002D08Rik
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37957431-37969774 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 37959873 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043437] [ENSMUST00000043498] [ENSMUST00000070709] [ENSMUST00000091932] [ENSMUST00000163128] [ENSMUST00000163591] [ENSMUST00000168056] [ENSMUST00000169360] [ENSMUST00000169498] [ENSMUST00000176104] [ENSMUST00000176902] [ENSMUST00000177058]
Predicted Effect probably benign
Transcript: ENSMUST00000043437
SMART Domains Protein: ENSMUSP00000047878
Gene: ENSMUSG00000038524

DomainStartEndE-ValueType
Pfam:FCH 21 100 1.6e-19 PFAM
coiled coil region 188 209 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
SH3 469 526 1.34e-8 SMART
SH3 547 606 1.94e-14 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043498
SMART Domains Protein: ENSMUSP00000037981
Gene: ENSMUSG00000024454

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 11 315 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070709
SMART Domains Protein: ENSMUSP00000070280
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091932
SMART Domains Protein: ENSMUSP00000089552
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 8.3e-23 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153945
Predicted Effect probably benign
Transcript: ENSMUST00000163128
SMART Domains Protein: ENSMUSP00000127234
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 5.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163591
SMART Domains Protein: ENSMUSP00000129299
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166727
Predicted Effect probably benign
Transcript: ENSMUST00000168056
SMART Domains Protein: ENSMUSP00000130051
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.9e-23 PFAM
low complexity region 104 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169360
SMART Domains Protein: ENSMUSP00000129880
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 4.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169498
SMART Domains Protein: ENSMUSP00000128949
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176104
SMART Domains Protein: ENSMUSP00000135556
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 60 3.3e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176902
SMART Domains Protein: ENSMUSP00000135176
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177058
SMART Domains Protein: ENSMUSP00000135615
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Fchsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Fchsd1 APN 18 37965893 intron probably benign
IGL01097:Fchsd1 APN 18 37967757 splice site probably null
IGL02069:Fchsd1 APN 18 37967614 nonsense probably null
R0015:Fchsd1 UTSW 18 37962959 missense probably benign 0.05
R0015:Fchsd1 UTSW 18 37962959 missense probably benign 0.05
R0755:Fchsd1 UTSW 18 37968750 splice site probably null
R1524:Fchsd1 UTSW 18 37965897 critical splice donor site probably null
R2041:Fchsd1 UTSW 18 37967676 critical splice acceptor site probably null
R3820:Fchsd1 UTSW 18 37969457 splice site probably benign
R3821:Fchsd1 UTSW 18 37969457 splice site probably benign
R4998:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5017:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5018:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5022:Fchsd1 UTSW 18 37964810 missense possibly damaging 0.80
R5023:Fchsd1 UTSW 18 37964810 missense possibly damaging 0.80
R5047:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5240:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5309:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5312:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5353:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5354:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5355:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5424:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5517:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5518:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5521:Fchsd1 UTSW 18 37966484 missense probably damaging 1.00
R5590:Fchsd1 UTSW 18 37961327 missense probably damaging 1.00
R5607:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5608:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5828:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5906:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5949:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5958:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5969:Fchsd1 UTSW 18 37959873 unclassified probably benign
R6245:Fchsd1 UTSW 18 37962775 missense probably damaging 1.00
R6322:Fchsd1 UTSW 18 37965700 missense probably benign 0.00
R6433:Fchsd1 UTSW 18 37964084 missense possibly damaging 0.91
R6439:Fchsd1 UTSW 18 37969434 missense probably damaging 0.97
R6460:Fchsd1 UTSW 18 37959844 splice site probably null
R6488:Fchsd1 UTSW 18 37967268 intron probably null
R6650:Fchsd1 UTSW 18 37966502 nonsense probably null
R7331:Fchsd1 UTSW 18 37968770 missense possibly damaging 0.95
X0024:Fchsd1 UTSW 18 37969391 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCTGTCTTAGGAATATCCCTGAC -3'
(R):5'- CTCAATAGGCATTTTGAGGGGC -3'

Sequencing Primer
(F):5'- GTCTTAGGAATATCCCTGACAATTC -3'
(R):5'- TTTATAGCTTAGGCTGCTG -3'
Posted On2016-12-15