Incidental Mutation 'R5810:Slc22a6'
ID447497
Institutional Source Beutler Lab
Gene Symbol Slc22a6
Ensembl Gene ENSMUSG00000024650
Gene Namesolute carrier family 22 (organic anion transporter), member 6
SynonymsNKT, Oat1, mOat1, Orctl1
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8617996-8628299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8623858 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 425 (K425E)
Ref Sequence ENSEMBL: ENSMUSP00000010250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010250]
Predicted Effect probably damaging
Transcript: ENSMUST00000010250
AA Change: K425E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010250
Gene: ENSMUSG00000024650
AA Change: K425E

DomainStartEndE-ValueType
Pfam:MFS_1 107 467 2.4e-25 PFAM
Pfam:Sugar_tr 107 512 8e-33 PFAM
low complexity region 520 531 N/A INTRINSIC
Meta Mutation Damage Score 0.1340 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the sodium-dependent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and may be localized to the basolateral membrane. Four transcript variants encoding four different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene may result in increased thymus weight or impaired renal organic anion excretion for a subset of organic anions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Npm3 A G 19: 45,748,205 I165T possibly damaging Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Slc22a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc22a6 APN 19 8621868 missense probably benign 0.14
IGL00825:Slc22a6 APN 19 8618357 missense possibly damaging 0.94
IGL01362:Slc22a6 APN 19 8621208 missense possibly damaging 0.69
IGL01843:Slc22a6 APN 19 8626214 utr 3 prime probably benign
IGL02583:Slc22a6 APN 19 8623616 missense possibly damaging 0.79
R1004:Slc22a6 UTSW 19 8618399 missense probably damaging 1.00
R1775:Slc22a6 UTSW 19 8619107 critical splice donor site probably null
R1911:Slc22a6 UTSW 19 8621882 missense probably benign
R2365:Slc22a6 UTSW 19 8619397 missense probably benign
R3406:Slc22a6 UTSW 19 8621311 missense probably damaging 1.00
R4106:Slc22a6 UTSW 19 8618510 missense probably benign
R4693:Slc22a6 UTSW 19 8623652 missense probably damaging 1.00
R5094:Slc22a6 UTSW 19 8626177 missense probably damaging 1.00
R5347:Slc22a6 UTSW 19 8618553 missense possibly damaging 0.94
R5360:Slc22a6 UTSW 19 8619422 missense probably damaging 1.00
R5667:Slc22a6 UTSW 19 8621784 critical splice acceptor site probably null
R6176:Slc22a6 UTSW 19 8621797 missense probably damaging 1.00
R6336:Slc22a6 UTSW 19 8622130 missense probably benign 0.02
R6864:Slc22a6 UTSW 19 8618441 missense probably damaging 1.00
R6954:Slc22a6 UTSW 19 8622096 missense probably benign 0.02
R7298:Slc22a6 UTSW 19 8621320 missense possibly damaging 0.49
R7305:Slc22a6 UTSW 19 8622158 critical splice donor site probably null
R7681:Slc22a6 UTSW 19 8626129 missense probably benign 0.03
R7749:Slc22a6 UTSW 19 8621896 missense possibly damaging 0.48
Z1088:Slc22a6 UTSW 19 8621833 missense probably benign 0.03
Z1176:Slc22a6 UTSW 19 8623543 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGAGCACTTGCCAGTCTCTC -3'
(R):5'- GACATGTGTAACTGAGTGGTTCC -3'

Sequencing Primer
(F):5'- GCCAGTCTCTCAGCTCTCAG -3'
(R):5'- TGGTTCCTATATATATTGCTCCAGTG -3'
Posted On2016-12-15