Incidental Mutation 'R5811:Lamc2'
ID 447501
Institutional Source Beutler Lab
Gene Symbol Lamc2
Ensembl Gene ENSMUSG00000026479
Gene Name laminin, gamma 2
Synonyms nicein, 100kDa
MMRRC Submission 043213-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.460) question?
Stock # R5811 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 152998502-153062193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 153041999 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 45 (R45Q)
Ref Sequence ENSEMBL: ENSMUSP00000140514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000185356]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000027753
AA Change: R45Q

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: R45Q

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000185356
AA Change: R45Q

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: R45Q

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188831
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,604,503 (GRCm39) K428M probably damaging Het
Chid1 G A 7: 141,110,166 (GRCm39) T53M probably damaging Het
Clnk A G 5: 38,870,490 (GRCm39) V356A probably damaging Het
Cryba4 C T 5: 112,398,937 (GRCm39) V36I probably benign Het
Dct A G 14: 118,250,600 (GRCm39) V466A probably benign Het
Dnmt3l A G 10: 77,887,929 (GRCm39) D146G possibly damaging Het
Epas1 A G 17: 87,131,203 (GRCm39) N328D probably damaging Het
Fat4 C T 3: 38,945,936 (GRCm39) R1610W probably damaging Het
Filip1l T C 16: 57,390,657 (GRCm39) V415A probably damaging Het
Garnl3 A G 2: 32,896,911 (GRCm39) L576P probably damaging Het
Gjd3 A T 11: 98,873,226 (GRCm39) V206E possibly damaging Het
Gpr135 A T 12: 72,116,641 (GRCm39) D375E possibly damaging Het
Gsdme T A 6: 50,222,925 (GRCm39) Q130L probably benign Het
Hcls1 A G 16: 36,777,702 (GRCm39) M274V probably null Het
Kcnn4 T C 7: 24,077,030 (GRCm39) V193A probably damaging Het
Kctd16 T C 18: 40,391,505 (GRCm39) V31A probably damaging Het
Lrrc66 T A 5: 73,772,860 (GRCm39) I203F possibly damaging Het
Mark4 T C 7: 19,182,564 (GRCm39) D91G probably damaging Het
Mcm6 A T 1: 128,263,465 (GRCm39) probably benign Het
Mecom C T 3: 30,015,149 (GRCm39) S602N probably benign Het
Muc5ac T C 7: 141,352,721 (GRCm39) V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,850,701 (GRCm39) probably benign Het
Or2h2c C A 17: 37,422,649 (GRCm39) C75F probably benign Het
Pdia5 A T 16: 35,269,790 (GRCm39) M173K possibly damaging Het
Pih1d2 T C 9: 50,532,374 (GRCm39) L144P probably damaging Het
Plch2 C T 4: 155,077,024 (GRCm39) E577K possibly damaging Het
Samd4b T C 7: 28,107,445 (GRCm39) S275G probably damaging Het
Sap130 T C 18: 31,822,495 (GRCm39) V668A probably benign Het
Sema3c T A 5: 17,880,188 (GRCm39) probably null Het
Slc9a8 C T 2: 167,313,307 (GRCm39) R390* probably null Het
Vmn2r89 A T 14: 51,693,565 (GRCm39) N305I probably benign Het
Wdr33 T C 18: 32,035,673 (GRCm39) F1164L unknown Het
Zfp873 T A 10: 81,896,567 (GRCm39) C470S probably damaging Het
Other mutations in Lamc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Lamc2 APN 1 153,005,802 (GRCm39) missense probably benign 0.00
IGL00907:Lamc2 APN 1 153,020,397 (GRCm39) missense probably benign 0.32
IGL02026:Lamc2 APN 1 153,020,482 (GRCm39) splice site probably benign
IGL02335:Lamc2 APN 1 153,041,962 (GRCm39) missense probably benign 0.00
IGL02568:Lamc2 APN 1 153,042,008 (GRCm39) missense possibly damaging 0.91
IGL02640:Lamc2 APN 1 153,027,803 (GRCm39) missense probably damaging 0.99
IGL02801:Lamc2 APN 1 153,012,529 (GRCm39) missense probably benign 0.10
IGL02827:Lamc2 APN 1 153,015,527 (GRCm39) missense probably damaging 1.00
IGL03240:Lamc2 APN 1 152,999,871 (GRCm39) missense probably damaging 1.00
IGL03245:Lamc2 APN 1 153,009,503 (GRCm39) splice site probably null
abasement UTSW 1 153,002,771 (GRCm39) missense probably null 0.86
ANU74:Lamc2 UTSW 1 153,007,581 (GRCm39) missense probably benign 0.00
R0279:Lamc2 UTSW 1 153,006,442 (GRCm39) missense probably benign 0.01
R0528:Lamc2 UTSW 1 152,999,840 (GRCm39) missense probably damaging 1.00
R0597:Lamc2 UTSW 1 153,009,367 (GRCm39) missense probably benign 0.02
R0650:Lamc2 UTSW 1 153,019,622 (GRCm39) missense possibly damaging 0.88
R0826:Lamc2 UTSW 1 153,027,828 (GRCm39) missense probably damaging 1.00
R1015:Lamc2 UTSW 1 153,041,945 (GRCm39) missense possibly damaging 0.53
R1172:Lamc2 UTSW 1 153,042,033 (GRCm39) missense probably damaging 1.00
R1308:Lamc2 UTSW 1 153,026,564 (GRCm39) missense probably damaging 1.00
R1521:Lamc2 UTSW 1 153,042,009 (GRCm39) missense probably benign 0.11
R1525:Lamc2 UTSW 1 153,006,502 (GRCm39) missense probably benign 0.00
R1602:Lamc2 UTSW 1 153,002,774 (GRCm39) missense probably benign 0.00
R1631:Lamc2 UTSW 1 153,034,680 (GRCm39) missense possibly damaging 0.95
R1633:Lamc2 UTSW 1 153,017,444 (GRCm39) nonsense probably null
R1832:Lamc2 UTSW 1 153,041,933 (GRCm39) missense possibly damaging 0.72
R1978:Lamc2 UTSW 1 153,009,343 (GRCm39) critical splice donor site probably null
R1996:Lamc2 UTSW 1 153,030,216 (GRCm39) missense possibly damaging 0.84
R2046:Lamc2 UTSW 1 153,017,511 (GRCm39) missense probably benign 0.01
R2107:Lamc2 UTSW 1 153,030,132 (GRCm39) splice site probably benign
R2130:Lamc2 UTSW 1 153,002,870 (GRCm39) missense probably damaging 1.00
R2182:Lamc2 UTSW 1 153,002,612 (GRCm39) missense possibly damaging 0.46
R2207:Lamc2 UTSW 1 153,009,452 (GRCm39) missense possibly damaging 0.68
R2218:Lamc2 UTSW 1 153,006,525 (GRCm39) missense probably benign 0.21
R3772:Lamc2 UTSW 1 152,999,997 (GRCm39) missense probably benign
R4616:Lamc2 UTSW 1 153,041,915 (GRCm39) missense probably damaging 1.00
R4874:Lamc2 UTSW 1 153,030,141 (GRCm39) missense probably null 1.00
R4939:Lamc2 UTSW 1 153,002,582 (GRCm39) missense probably damaging 1.00
R4985:Lamc2 UTSW 1 153,012,551 (GRCm39) missense probably benign
R5544:Lamc2 UTSW 1 152,999,799 (GRCm39) missense possibly damaging 0.93
R5632:Lamc2 UTSW 1 153,007,636 (GRCm39) missense probably damaging 1.00
R5771:Lamc2 UTSW 1 153,017,340 (GRCm39) missense probably benign 0.04
R6058:Lamc2 UTSW 1 153,012,575 (GRCm39) missense probably benign 0.01
R6130:Lamc2 UTSW 1 153,012,523 (GRCm39) missense probably benign 0.01
R6137:Lamc2 UTSW 1 153,041,899 (GRCm39) missense possibly damaging 0.90
R6994:Lamc2 UTSW 1 153,012,508 (GRCm39) missense probably benign 0.18
R6995:Lamc2 UTSW 1 153,012,508 (GRCm39) missense probably benign 0.18
R6997:Lamc2 UTSW 1 153,012,508 (GRCm39) missense probably benign 0.18
R7000:Lamc2 UTSW 1 153,041,873 (GRCm39) missense possibly damaging 0.72
R7018:Lamc2 UTSW 1 153,012,488 (GRCm39) missense probably benign 0.00
R7145:Lamc2 UTSW 1 153,006,518 (GRCm39) missense possibly damaging 0.95
R7148:Lamc2 UTSW 1 153,061,730 (GRCm39) missense probably benign 0.01
R7171:Lamc2 UTSW 1 153,015,495 (GRCm39) missense probably damaging 1.00
R7640:Lamc2 UTSW 1 153,012,550 (GRCm39) missense possibly damaging 0.79
R7673:Lamc2 UTSW 1 152,999,782 (GRCm39) missense probably damaging 1.00
R7684:Lamc2 UTSW 1 153,002,771 (GRCm39) missense probably null 0.86
R7712:Lamc2 UTSW 1 153,009,357 (GRCm39) missense possibly damaging 0.81
R7940:Lamc2 UTSW 1 153,006,521 (GRCm39) nonsense probably null
R8153:Lamc2 UTSW 1 152,999,850 (GRCm39) frame shift probably null
R8211:Lamc2 UTSW 1 153,042,024 (GRCm39) missense probably damaging 1.00
R8486:Lamc2 UTSW 1 153,034,637 (GRCm39) missense probably benign
R8739:Lamc2 UTSW 1 153,020,399 (GRCm39) nonsense probably null
R8744:Lamc2 UTSW 1 153,019,484 (GRCm39) missense probably benign 0.19
R8911:Lamc2 UTSW 1 153,027,873 (GRCm39) missense probably damaging 1.00
R9435:Lamc2 UTSW 1 153,013,072 (GRCm39) missense probably benign 0.00
R9457:Lamc2 UTSW 1 153,015,600 (GRCm39) missense probably benign
RF024:Lamc2 UTSW 1 153,027,801 (GRCm39) missense possibly damaging 0.70
Z1176:Lamc2 UTSW 1 153,009,367 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GACCCAGTTGTGCAACATCTC -3'
(R):5'- GCTAGAGAGTTGCATGAGAGTCC -3'

Sequencing Primer
(F):5'- ACCCAGTTGTGCAACATCTCTCTAG -3'
(R):5'- TACAGGGAATTCTCTGCAGC -3'
Posted On 2016-12-15