Incidental Mutation 'R5811:Sema3c'
ID 447509
Institutional Source Beutler Lab
Gene Symbol Sema3c
Ensembl Gene ENSMUSG00000028780
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms Semae, 1110036B02Rik
MMRRC Submission 043213-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5811 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 17779814-17935266 bp(+) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to A at 17880188 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030568] [ENSMUST00000169603] [ENSMUST00000170181]
AlphaFold Q62181
Predicted Effect probably null
Transcript: ENSMUST00000030568
SMART Domains Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Sema 54 495 1.16e-200 SMART
PSI 513 565 2.87e-13 SMART
IG 577 662 7.08e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169603
SMART Domains Protein: ENSMUSP00000132330
Gene: ENSMUSG00000028780

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Sema 54 226 9.6e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170181
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,604,503 (GRCm39) K428M probably damaging Het
Chid1 G A 7: 141,110,166 (GRCm39) T53M probably damaging Het
Clnk A G 5: 38,870,490 (GRCm39) V356A probably damaging Het
Cryba4 C T 5: 112,398,937 (GRCm39) V36I probably benign Het
Dct A G 14: 118,250,600 (GRCm39) V466A probably benign Het
Dnmt3l A G 10: 77,887,929 (GRCm39) D146G possibly damaging Het
Epas1 A G 17: 87,131,203 (GRCm39) N328D probably damaging Het
Fat4 C T 3: 38,945,936 (GRCm39) R1610W probably damaging Het
Filip1l T C 16: 57,390,657 (GRCm39) V415A probably damaging Het
Garnl3 A G 2: 32,896,911 (GRCm39) L576P probably damaging Het
Gjd3 A T 11: 98,873,226 (GRCm39) V206E possibly damaging Het
Gpr135 A T 12: 72,116,641 (GRCm39) D375E possibly damaging Het
Gsdme T A 6: 50,222,925 (GRCm39) Q130L probably benign Het
Hcls1 A G 16: 36,777,702 (GRCm39) M274V probably null Het
Kcnn4 T C 7: 24,077,030 (GRCm39) V193A probably damaging Het
Kctd16 T C 18: 40,391,505 (GRCm39) V31A probably damaging Het
Lamc2 C T 1: 153,041,999 (GRCm39) R45Q possibly damaging Het
Lrrc66 T A 5: 73,772,860 (GRCm39) I203F possibly damaging Het
Mark4 T C 7: 19,182,564 (GRCm39) D91G probably damaging Het
Mcm6 A T 1: 128,263,465 (GRCm39) probably benign Het
Mecom C T 3: 30,015,149 (GRCm39) S602N probably benign Het
Muc5ac T C 7: 141,352,721 (GRCm39) V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,850,701 (GRCm39) probably benign Het
Or2h2c C A 17: 37,422,649 (GRCm39) C75F probably benign Het
Pdia5 A T 16: 35,269,790 (GRCm39) M173K possibly damaging Het
Pih1d2 T C 9: 50,532,374 (GRCm39) L144P probably damaging Het
Plch2 C T 4: 155,077,024 (GRCm39) E577K possibly damaging Het
Samd4b T C 7: 28,107,445 (GRCm39) S275G probably damaging Het
Sap130 T C 18: 31,822,495 (GRCm39) V668A probably benign Het
Slc9a8 C T 2: 167,313,307 (GRCm39) R390* probably null Het
Vmn2r89 A T 14: 51,693,565 (GRCm39) N305I probably benign Het
Wdr33 T C 18: 32,035,673 (GRCm39) F1164L unknown Het
Zfp873 T A 10: 81,896,567 (GRCm39) C470S probably damaging Het
Other mutations in Sema3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3c APN 5 17,899,858 (GRCm39) missense probably damaging 1.00
IGL01528:Sema3c APN 5 17,919,413 (GRCm39) missense probably benign
IGL01618:Sema3c APN 5 17,877,504 (GRCm39) missense probably damaging 1.00
IGL01730:Sema3c APN 5 17,916,434 (GRCm39) missense probably benign 0.01
IGL01762:Sema3c APN 5 17,899,849 (GRCm39) missense possibly damaging 0.81
IGL02049:Sema3c APN 5 17,926,923 (GRCm39) splice site probably benign
IGL02249:Sema3c APN 5 17,867,961 (GRCm39) missense probably damaging 1.00
IGL02657:Sema3c APN 5 17,867,972 (GRCm39) missense probably damaging 1.00
IGL02657:Sema3c APN 5 17,781,866 (GRCm39) start codon destroyed possibly damaging 0.71
IGL03213:Sema3c APN 5 17,899,637 (GRCm39) splice site probably benign
PIT4651001:Sema3c UTSW 5 17,899,731 (GRCm39) missense probably benign 0.37
R0031:Sema3c UTSW 5 17,899,726 (GRCm39) missense probably damaging 1.00
R0558:Sema3c UTSW 5 17,919,413 (GRCm39) missense probably benign 0.00
R0964:Sema3c UTSW 5 17,926,907 (GRCm39) missense probably damaging 1.00
R1164:Sema3c UTSW 5 17,883,312 (GRCm39) missense probably benign 0.40
R1351:Sema3c UTSW 5 17,883,334 (GRCm39) missense possibly damaging 0.60
R1368:Sema3c UTSW 5 17,883,330 (GRCm39) missense possibly damaging 0.96
R1480:Sema3c UTSW 5 17,887,029 (GRCm39) missense possibly damaging 0.57
R1880:Sema3c UTSW 5 17,932,464 (GRCm39) nonsense probably null
R1916:Sema3c UTSW 5 17,932,399 (GRCm39) missense probably benign 0.06
R3934:Sema3c UTSW 5 17,886,938 (GRCm39) missense probably damaging 0.97
R4284:Sema3c UTSW 5 17,883,345 (GRCm39) missense probably benign 0.01
R4449:Sema3c UTSW 5 17,781,844 (GRCm39) start gained probably benign
R4545:Sema3c UTSW 5 17,899,770 (GRCm39) missense probably benign 0.01
R4546:Sema3c UTSW 5 17,899,770 (GRCm39) missense probably benign 0.01
R4660:Sema3c UTSW 5 17,877,511 (GRCm39) missense probably damaging 1.00
R4890:Sema3c UTSW 5 17,880,157 (GRCm39) missense probably benign 0.00
R4937:Sema3c UTSW 5 17,899,684 (GRCm39) missense probably benign 0.01
R5065:Sema3c UTSW 5 17,932,615 (GRCm39) missense possibly damaging 0.89
R5145:Sema3c UTSW 5 17,932,615 (GRCm39) missense possibly damaging 0.89
R5452:Sema3c UTSW 5 17,922,068 (GRCm39) critical splice donor site probably null
R5586:Sema3c UTSW 5 17,916,422 (GRCm39) missense probably damaging 0.99
R5886:Sema3c UTSW 5 17,886,984 (GRCm39) missense possibly damaging 0.90
R6120:Sema3c UTSW 5 17,932,630 (GRCm39) missense probably benign 0.00
R6191:Sema3c UTSW 5 17,858,804 (GRCm39) missense probably damaging 1.00
R6318:Sema3c UTSW 5 17,877,430 (GRCm39) missense probably damaging 0.96
R6416:Sema3c UTSW 5 17,781,959 (GRCm39) missense probably damaging 0.99
R6441:Sema3c UTSW 5 17,929,130 (GRCm39) missense possibly damaging 0.96
R6816:Sema3c UTSW 5 17,875,463 (GRCm39) missense probably benign 0.36
R7146:Sema3c UTSW 5 17,899,701 (GRCm39) missense probably benign 0.22
R7526:Sema3c UTSW 5 17,932,594 (GRCm39) missense possibly damaging 0.46
R7832:Sema3c UTSW 5 17,899,845 (GRCm39) missense probably damaging 0.99
R8034:Sema3c UTSW 5 17,932,480 (GRCm39) missense probably damaging 1.00
R8053:Sema3c UTSW 5 17,860,020 (GRCm39) missense probably benign 0.00
R8076:Sema3c UTSW 5 17,932,362 (GRCm39) missense probably benign 0.00
R8264:Sema3c UTSW 5 17,881,537 (GRCm39) intron probably benign
R8359:Sema3c UTSW 5 17,858,726 (GRCm39) missense possibly damaging 0.56
R8437:Sema3c UTSW 5 17,867,936 (GRCm39) missense probably damaging 0.99
R9174:Sema3c UTSW 5 17,868,039 (GRCm39) critical splice donor site probably null
R9295:Sema3c UTSW 5 17,932,495 (GRCm39) missense probably benign 0.09
R9477:Sema3c UTSW 5 17,921,981 (GRCm39) missense
R9599:Sema3c UTSW 5 17,919,452 (GRCm39) critical splice donor site probably null
R9702:Sema3c UTSW 5 17,858,828 (GRCm39) missense probably damaging 1.00
Z1176:Sema3c UTSW 5 17,932,517 (GRCm39) missense probably benign 0.04
Z1177:Sema3c UTSW 5 17,922,029 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTGTGTGATACTCTCCATG -3'
(R):5'- TGAATGCAGCACAGTAGGAAATTAC -3'

Sequencing Primer
(F):5'- CTGTGTGATACTCTCCATGATGTATG -3'
(R):5'- TGCAGCACAGTAGGAAATTACAAAAC -3'
Posted On 2016-12-15