Incidental Mutation 'R5811:Clnk'
ID447510
Institutional Source Beutler Lab
Gene Symbol Clnk
Ensembl Gene ENSMUSG00000039315
Gene Namecytokine-dependent hematopoietic cell linker
SynonymsMIST
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location38706462-38876812 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38713147 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 356 (V356A)
Ref Sequence ENSEMBL: ENSMUSP00000132779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169819] [ENSMUST00000171633]
Predicted Effect probably damaging
Transcript: ENSMUST00000169819
AA Change: V356A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128473
Gene: ENSMUSG00000039315
AA Change: V356A

DomainStartEndE-ValueType
low complexity region 158 188 N/A INTRINSIC
SH2 307 398 3.53e-19 SMART
low complexity region 414 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171633
AA Change: V356A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132779
Gene: ENSMUSG00000039315
AA Change: V356A

DomainStartEndE-ValueType
low complexity region 158 188 N/A INTRINSIC
SH2 307 398 3.53e-19 SMART
low complexity region 414 427 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MIST is a member of the SLP76 family of adaptors (see LCP2, MIM 601603; BLNK, MIM 604515). MIST plays a role in the regulation of immunoreceptor signaling, including PLC-gamma (PLCG1; MIM 172420)-mediated B cell antigen receptor (BCR) signaling and FC-epsilon R1 (see FCER1A, MIM 147140)-mediated mast cell degranulation (Cao et al., 1999 [PubMed 10562326]; Goitsuka et al., 2000, 2001 [PubMed 10744659] [PubMed 11463797]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a reporter allele display altered natural killer (NK) T cell physiology and enhanced NK cell cytolysis. Mice homozygous for knock-out allele display abnormal mast cell physiology as well as enhanced NK cell cytolysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dct A G 14: 118,013,188 V466A probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Clnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Clnk APN 5 38784528 missense possibly damaging 0.95
IGL01348:Clnk APN 5 38713207 missense probably damaging 1.00
IGL01901:Clnk APN 5 38794978 missense probably damaging 1.00
IGL01908:Clnk APN 5 38713142 missense probably damaging 1.00
IGL02437:Clnk APN 5 38774566 critical splice donor site probably null
IGL02745:Clnk APN 5 38736319 missense probably benign 0.00
R0138:Clnk UTSW 5 38774608 splice site probably benign
R0196:Clnk UTSW 5 38769939 missense probably damaging 0.97
R1522:Clnk UTSW 5 38794966 missense probably damaging 1.00
R1958:Clnk UTSW 5 38706626 missense possibly damaging 0.96
R2036:Clnk UTSW 5 38752800 splice site probably null
R2238:Clnk UTSW 5 38764351 splice site probably benign
R3788:Clnk UTSW 5 38714998 missense probably damaging 1.00
R3931:Clnk UTSW 5 38768069 missense probably benign
R4159:Clnk UTSW 5 38741795 intron probably benign
R4182:Clnk UTSW 5 38747850 intron probably benign
R4686:Clnk UTSW 5 38741837 intron probably benign
R4751:Clnk UTSW 5 38720913 missense probably benign 0.06
R4842:Clnk UTSW 5 38713069 splice site probably null
R6236:Clnk UTSW 5 38713199 missense probably benign 0.41
R7157:Clnk UTSW 5 38769891 missense possibly damaging 0.63
R7615:Clnk UTSW 5 38706698 missense probably damaging 1.00
R7618:Clnk UTSW 5 38736355 missense probably benign 0.06
R7762:Clnk UTSW 5 38768141 missense probably benign 0.24
R7768:Clnk UTSW 5 38768158 missense probably damaging 1.00
R7823:Clnk UTSW 5 38750351 missense probably benign 0.00
R8158:Clnk UTSW 5 38794911 critical splice donor site probably null
R8423:Clnk UTSW 5 38794910 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGATATCACTGCAGTGTCTCTCC -3'
(R):5'- TGCCAAAACTGAATCCACGG -3'

Sequencing Primer
(F):5'- TGTGTTCACTGGGGTATGTAGACAAG -3'
(R):5'- TGAATCCACGGAAGAATCTCATAAG -3'
Posted On2016-12-15