Incidental Mutation 'R5811:Cryba4'
ID447513
Institutional Source Beutler Lab
Gene Symbol Cryba4
Ensembl Gene ENSMUSG00000066975
Gene Namecrystallin, beta A4
Synonyms
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location112246493-112252518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 112251071 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 36 (V36I)
Ref Sequence ENSEMBL: ENSMUSP00000108004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031286] [ENSMUST00000086629] [ENSMUST00000112375] [ENSMUST00000112383] [ENSMUST00000112385] [ENSMUST00000131673]
Predicted Effect probably benign
Transcript: ENSMUST00000031286
SMART Domains Protein: ENSMUSP00000031286
Gene: ENSMUSG00000029343

DomainStartEndE-ValueType
low complexity region 19 47 N/A INTRINSIC
XTALbg 58 140 9.71e-40 SMART
XTALbg 148 230 5.8e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086629
AA Change: V36I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083826
Gene: ENSMUSG00000066975
AA Change: V36I

DomainStartEndE-ValueType
XTALbg 13 97 1.08e-37 SMART
XTALbg 106 194 2.59e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112375
SMART Domains Protein: ENSMUSP00000107994
Gene: ENSMUSG00000029343

DomainStartEndE-ValueType
low complexity region 19 47 N/A INTRINSIC
XTALbg 58 140 9.71e-40 SMART
XTALbg 148 230 5.8e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112383
AA Change: V23I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108002
Gene: ENSMUSG00000066975
AA Change: V23I

DomainStartEndE-ValueType
XTALbg 1 84 1.71e-35 SMART
XTALbg 93 181 2.59e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112385
AA Change: V36I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108004
Gene: ENSMUSG00000066975
AA Change: V36I

DomainStartEndE-ValueType
XTALbg 13 97 1.08e-37 SMART
XTALbg 106 194 2.59e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131673
SMART Domains Protein: ENSMUSP00000118399
Gene: ENSMUSG00000029343

DomainStartEndE-ValueType
low complexity region 19 47 N/A INTRINSIC
XTALbg 58 140 9.71e-40 SMART
XTALbg 148 230 5.8e-38 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the crystallin family of proteins that contribute to the transparency and refractive properties of the ocular lens. Certain mutations in the human ortholog of this gene are associated with cataract and bilateral microphthalmia. This gene is located adjacent to a related crystallin gene on chromosome 5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Dct A G 14: 118,013,188 V466A probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Cryba4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Cryba4 APN 5 112251009 unclassified probably benign
R0741:Cryba4 UTSW 5 112246688 missense probably damaging 1.00
R5622:Cryba4 UTSW 5 112251124 missense probably damaging 1.00
R6644:Cryba4 UTSW 5 112246762 missense probably damaging 1.00
R7008:Cryba4 UTSW 5 112251782 missense probably benign
R7554:Cryba4 UTSW 5 112251103 missense probably damaging 0.99
R7556:Cryba4 UTSW 5 112251103 missense probably damaging 0.99
R7671:Cryba4 UTSW 5 112248173 critical splice donor site probably null
R7888:Cryba4 UTSW 5 112251052 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACAGTGCAAGCCTGGAAAG -3'
(R):5'- AAATTGTGCTGTCCAGGATCCC -3'

Sequencing Primer
(F):5'- GATGTACCTAGGATCATACACAGGC -3'
(R):5'- CCTGGAGGCATGTGACCTCTG -3'
Posted On2016-12-15