Incidental Mutation 'R5811:Gsdme'
ID447514
Institutional Source Beutler Lab
Gene Symbol Gsdme
Ensembl Gene ENSMUSG00000029821
Gene Namegasdermin E
Synonyms4932441K13Rik, Dfna5h, Dfna5, Fin15, 2310037D07Rik
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location50188888-50263862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50245945 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 130 (Q130L)
Ref Sequence ENSEMBL: ENSMUSP00000126759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031845] [ENSMUST00000101405] [ENSMUST00000165099] [ENSMUST00000167893] [ENSMUST00000170142]
Predicted Effect probably benign
Transcript: ENSMUST00000031845
AA Change: Q130L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000031845
Gene: ENSMUSG00000029821
AA Change: Q130L

DomainStartEndE-ValueType
Pfam:Gasdermin 1 473 4.8e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101405
AA Change: Q130L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000098952
Gene: ENSMUSG00000029821
AA Change: Q130L

DomainStartEndE-ValueType
Pfam:Gasdermin 1 399 2e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165099
AA Change: Q130L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000130522
Gene: ENSMUSG00000029821
AA Change: Q130L

DomainStartEndE-ValueType
Pfam:Gasdermin 1 424 1.7e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167893
SMART Domains Protein: ENSMUSP00000132062
Gene: ENSMUSG00000029821

DomainStartEndE-ValueType
Pfam:Gasdermin 1 123 5.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170142
AA Change: Q130L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126759
Gene: ENSMUSG00000029821
AA Change: Q130L

DomainStartEndE-ValueType
Pfam:Gasdermin 1 473 2.3e-149 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hearing impairment is a heterogeneous condition with over 40 loci described. The protein encoded by this gene is expressed in fetal cochlea, however, its function is not known. Nonsyndromic hearing impairment is associated with a mutation in this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal numbers of cochlear hair cell but have normal hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dct A G 14: 118,013,188 V466A probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Gsdme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gsdme APN 6 50229284 critical splice donor site probably null
IGL01462:Gsdme APN 6 50227374 missense possibly damaging 0.94
IGL01645:Gsdme APN 6 50251336 missense probably damaging 1.00
IGL01836:Gsdme APN 6 50222789 missense probably damaging 1.00
R0060:Gsdme UTSW 6 50221029 missense possibly damaging 0.73
R0060:Gsdme UTSW 6 50221029 missense possibly damaging 0.73
R0110:Gsdme UTSW 6 50246127 splice site probably benign
R0396:Gsdme UTSW 6 50221107 missense probably benign 0.00
R0510:Gsdme UTSW 6 50246127 splice site probably benign
R0627:Gsdme UTSW 6 50229279 splice site probably benign
R1350:Gsdme UTSW 6 50246128 splice site probably null
R1992:Gsdme UTSW 6 50208122 missense probably damaging 1.00
R2869:Gsdme UTSW 6 50208177 nonsense probably null
R2869:Gsdme UTSW 6 50208177 nonsense probably null
R2973:Gsdme UTSW 6 50229324 missense probably damaging 1.00
R2974:Gsdme UTSW 6 50229324 missense probably damaging 1.00
R3154:Gsdme UTSW 6 50251363 missense probably damaging 0.99
R3816:Gsdme UTSW 6 50219411 missense probably benign 0.41
R3818:Gsdme UTSW 6 50219411 missense probably benign 0.41
R3819:Gsdme UTSW 6 50219411 missense probably benign 0.41
R4035:Gsdme UTSW 6 50229448 missense possibly damaging 0.50
R4519:Gsdme UTSW 6 50229353 missense probably damaging 1.00
R4669:Gsdme UTSW 6 50208122 missense probably damaging 1.00
R4678:Gsdme UTSW 6 50229324 missense possibly damaging 0.87
R5009:Gsdme UTSW 6 50246012 missense possibly damaging 0.64
R5370:Gsdme UTSW 6 50229306 missense probably damaging 0.98
R5768:Gsdme UTSW 6 50219300 nonsense probably null
R5975:Gsdme UTSW 6 50227359 missense probably benign 0.30
R6032:Gsdme UTSW 6 50245954 missense probably damaging 1.00
R6032:Gsdme UTSW 6 50245954 missense probably damaging 1.00
R6035:Gsdme UTSW 6 50229326 missense probably damaging 0.99
R6035:Gsdme UTSW 6 50229326 missense probably damaging 0.99
R6089:Gsdme UTSW 6 50251305 missense probably damaging 0.99
R6565:Gsdme UTSW 6 50229449 missense probably damaging 0.97
R6862:Gsdme UTSW 6 50227398 missense probably damaging 1.00
R7169:Gsdme UTSW 6 50227378 missense probably benign 0.00
R7720:Gsdme UTSW 6 50229308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGGACTAAATCTTCCCAC -3'
(R):5'- CAGTGGTTGTGGAGTCAGAC -3'

Sequencing Primer
(F):5'- CGAGTCAATTTAAGAGCCTATGACC -3'
(R):5'- TGTGGAGTCAGACTTCGTGAAATAC -3'
Posted On2016-12-15