Incidental Mutation 'R5811:Kcnn4'
ID447516
Institutional Source Beutler Lab
Gene Symbol Kcnn4
Ensembl Gene ENSMUSG00000054342
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
SynonymsKCa3.1, IK1, SK4, IKCa1, mIKCa1
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24370263-24386690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24377605 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 193 (V193A)
Ref Sequence ENSEMBL: ENSMUSP00000146012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171904] [ENSMUST00000205428] [ENSMUST00000205626]
Predicted Effect probably damaging
Transcript: ENSMUST00000171904
AA Change: V193A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133065
Gene: ENSMUSG00000054342
AA Change: V193A

DomainStartEndE-ValueType
Pfam:SK_channel 11 124 1.7e-41 PFAM
low complexity region 143 160 N/A INTRINSIC
Pfam:Ion_trans_2 209 289 2.6e-16 PFAM
CaMBD 302 375 1.85e-32 SMART
low complexity region 411 424 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205428
AA Change: V193A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000205626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205881
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a potentially heterotetrameric voltage-independent potassium channel that is activated by intracellular calcium. Activation is followed by membrane hyperpolarization, which promotes calcium influx. The encoded protein may be part of the predominant calcium-activated potassium channel in T-lymphocytes. This gene is similar to other KCNN family potassium channel genes, but it differs enough to possibly be considered as part of a new subfamily. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice have increased parotid gland weight and both sexes have impaired volume regulation in erythrocytes and T lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dct A G 14: 118,013,188 V466A probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Kcnn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Kcnn4 APN 7 24381703 missense probably benign 0.05
IGL02958:Kcnn4 APN 7 24374745 missense probably benign 0.00
ivanhoe UTSW 7 24374742 missense probably damaging 1.00
longbow UTSW 7 24379255 missense possibly damaging 0.88
R0009:Kcnn4 UTSW 7 24379255 missense possibly damaging 0.88
R1706:Kcnn4 UTSW 7 24374742 missense probably damaging 1.00
R4300:Kcnn4 UTSW 7 24377604 missense probably benign 0.21
R4402:Kcnn4 UTSW 7 24377442 missense probably benign 0.12
R5455:Kcnn4 UTSW 7 24377553 missense probably damaging 1.00
R6319:Kcnn4 UTSW 7 24381740 missense possibly damaging 0.89
R8098:Kcnn4 UTSW 7 24384079 missense probably damaging 0.99
R8322:Kcnn4 UTSW 7 24384120 missense probably benign
R8376:Kcnn4 UTSW 7 24377626 missense possibly damaging 0.47
R8871:Kcnn4 UTSW 7 24384075 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTTCATGACTGACAACGGGC -3'
(R):5'- ATGGAAAGTGTGAGCCTGC -3'

Sequencing Primer
(F):5'- AGGTGGCGCAGATCCTG -3'
(R):5'- AAGTGTGAGCCTGCCCTGATG -3'
Posted On2016-12-15