Incidental Mutation 'R5811:Samd4b'
ID447517
Institutional Source Beutler Lab
Gene Symbol Samd4b
Ensembl Gene ENSMUSG00000109336
Gene Namesterile alpha motif domain containing 4B
Synonyms
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28399522-28598144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28408020 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 275 (S275G)
Ref Sequence ENSEMBL: ENSMUSP00000147037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040531] [ENSMUST00000207766] [ENSMUST00000208126] [ENSMUST00000208199]
Predicted Effect probably damaging
Transcript: ENSMUST00000040531
AA Change: S275G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336
AA Change: S275G

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207766
AA Change: Q224R
Predicted Effect probably benign
Transcript: ENSMUST00000208126
Predicted Effect probably damaging
Transcript: ENSMUST00000208199
AA Change: S275G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208676
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dct A G 14: 118,013,188 V466A probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Samd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Samd4b APN 7 28401877 missense probably damaging 1.00
IGL00979:Samd4b APN 7 28414213 missense probably damaging 1.00
IGL01336:Samd4b APN 7 28413963 missense probably benign 0.00
IGL01432:Samd4b APN 7 28414066 missense possibly damaging 0.60
IGL01895:Samd4b APN 7 28401909 critical splice acceptor site probably null
IGL02827:Samd4b APN 7 28414121 missense probably damaging 1.00
IGL03077:Samd4b APN 7 28406443 missense probably damaging 0.99
IGL03055:Samd4b UTSW 7 28405546 missense possibly damaging 0.89
R0367:Samd4b UTSW 7 28423448 missense probably damaging 1.00
R0390:Samd4b UTSW 7 28403977 missense probably benign 0.13
R0440:Samd4b UTSW 7 28408160 missense probably benign 0.45
R0488:Samd4b UTSW 7 28414237 missense probably damaging 1.00
R0798:Samd4b UTSW 7 28401623 splice site probably benign
R1233:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1234:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1481:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1643:Samd4b UTSW 7 28423616 missense probably damaging 1.00
R1675:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1768:Samd4b UTSW 7 28413892 missense probably benign 0.36
R1801:Samd4b UTSW 7 28407331 splice site probably null
R2831:Samd4b UTSW 7 28403913 missense probably damaging 0.99
R4505:Samd4b UTSW 7 28407500 missense probably benign 0.15
R4507:Samd4b UTSW 7 28407500 missense probably benign 0.15
R4731:Samd4b UTSW 7 28406663 missense probably benign 0.00
R6063:Samd4b UTSW 7 28423631 start codon destroyed possibly damaging 0.71
R6114:Samd4b UTSW 7 28522792 splice site probably null
R6356:Samd4b UTSW 7 28401593 missense probably damaging 1.00
R6467:Samd4b UTSW 7 28401860 missense probably damaging 1.00
R7055:Samd4b UTSW 7 28404033 missense probably benign 0.01
R7191:Samd4b UTSW 7 28414261 missense probably benign 0.18
R7371:Samd4b UTSW 7 28423501 missense probably benign 0.33
R7445:Samd4b UTSW 7 28406456 missense probably benign 0.00
R7543:Samd4b UTSW 7 28414286 missense probably benign 0.02
R7663:Samd4b UTSW 7 28423500 nonsense probably null
R7746:Samd4b UTSW 7 28403903 missense probably damaging 1.00
R7991:Samd4b UTSW 7 28404033 missense probably benign 0.01
R8235:Samd4b UTSW 7 28406606 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACCTGTGTCCTCCCTGAG -3'
(R):5'- AAGATTGATCGGGCCATGG -3'

Sequencing Primer
(F):5'- GGTGGCAGCTACAGGCAATTTTC -3'
(R):5'- ATGCTCAGATACCCTATCCTGAC -3'
Posted On2016-12-15