Incidental Mutation 'R5811:Chid1'
ID447518
Institutional Source Beutler Lab
Gene Symbol Chid1
Ensembl Gene ENSMUSG00000025512
Gene Namechitinase domain containing 1
Synonyms
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141493136-141539857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141530253 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 53 (T53M)
Ref Sequence ENSEMBL: ENSMUSP00000147938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026586] [ENSMUST00000118694] [ENSMUST00000143561] [ENSMUST00000153191] [ENSMUST00000166082] [ENSMUST00000209452]
Predicted Effect probably damaging
Transcript: ENSMUST00000026586
AA Change: T56M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026586
Gene: ENSMUSG00000025512
AA Change: T56M

DomainStartEndE-ValueType
PDB:3BXW|A 4 240 1e-142 PDB
Blast:Glyco_18 82 302 1e-139 BLAST
SCOP:d1e9la1 84 240 1e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000064642
AA Change: T54M
SMART Domains Protein: ENSMUSP00000065953
Gene: ENSMUSG00000025512
AA Change: T54M

DomainStartEndE-ValueType
PDB:3BXW|A 3 236 1e-143 PDB
Blast:Glyco_18 81 268 1e-121 BLAST
SCOP:d1e9la1 83 236 2e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118694
AA Change: T53M

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112891
Gene: ENSMUSG00000025512
AA Change: T53M

DomainStartEndE-ValueType
PDB:3BXW|A 1 237 1e-142 PDB
Blast:Glyco_18 79 299 1e-139 BLAST
SCOP:d1e9la1 81 237 1e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133359
Predicted Effect probably damaging
Transcript: ENSMUST00000143561
AA Change: T53M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115174
Gene: ENSMUSG00000025512
AA Change: T53M

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
Pfam:Glyco_hydro_18 79 263 4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147610
Predicted Effect possibly damaging
Transcript: ENSMUST00000153191
AA Change: T53M

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114693
Gene: ENSMUSG00000025512
AA Change: T53M

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
Glyco_18 79 385 3.54e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155305
Predicted Effect probably damaging
Transcript: ENSMUST00000166082
AA Change: T56M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130360
Gene: ENSMUSG00000025512
AA Change: T56M

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Glyco_18 82 388 3.54e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209452
AA Change: T53M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dct A G 14: 118,013,188 V466A probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Chid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Chid1 APN 7 141522696 missense probably damaging 1.00
IGL01095:Chid1 APN 7 141530229 missense probably damaging 1.00
IGL01382:Chid1 APN 7 141530253 missense probably damaging 1.00
IGL01505:Chid1 APN 7 141513894 splice site probably null
IGL02108:Chid1 APN 7 141532928 start codon destroyed probably null 0.98
IGL02216:Chid1 APN 7 141496593 splice site probably benign
IGL02574:Chid1 APN 7 141496690 splice site probably benign
R0006:Chid1 UTSW 7 141496426 splice site probably benign
R0006:Chid1 UTSW 7 141496426 splice site probably benign
R0711:Chid1 UTSW 7 141496677 missense probably benign
R1518:Chid1 UTSW 7 141528471 missense probably damaging 0.98
R1836:Chid1 UTSW 7 141526496 splice site probably null
R5026:Chid1 UTSW 7 141513836 missense probably damaging 0.99
R5516:Chid1 UTSW 7 141496146 missense probably damaging 1.00
R6009:Chid1 UTSW 7 141529580 missense probably damaging 1.00
R6182:Chid1 UTSW 7 141528502 missense probably benign 0.08
R6238:Chid1 UTSW 7 141496136 missense probably benign 0.03
R6966:Chid1 UTSW 7 141496384 missense possibly damaging 0.89
R7106:Chid1 UTSW 7 141522660 missense probably benign 0.01
R7278:Chid1 UTSW 7 141529488 splice site probably null
R7773:Chid1 UTSW 7 141529605 missense probably benign 0.02
R8714:Chid1 UTSW 7 141513765 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATATTAGCAGCAGCCACG -3'
(R):5'- TGGCCTTAATCCTCTACCTACAAG -3'

Sequencing Primer
(F):5'- TATTAGCAGCAGCCACGGAGAG -3'
(R):5'- GGTAGATCAGCAGTGCCATGTTAATC -3'
Posted On2016-12-15