Incidental Mutation 'R5811:Dnmt3l'
ID447522
Institutional Source Beutler Lab
Gene Symbol Dnmt3l
Ensembl Gene ENSMUSG00000000730
Gene NameDNA (cytosine-5-)-methyltransferase 3-like
SynonymsD6Ertd14e, ecat7
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78041947-78063622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78052095 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 146 (D146G)
Ref Sequence ENSEMBL: ENSMUSP00000116970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000746] [ENSMUST00000123940] [ENSMUST00000131825] [ENSMUST00000138785] [ENSMUST00000139539] [ENSMUST00000151242]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000746
AA Change: D146G

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000000746
Gene: ENSMUSG00000000730
AA Change: D146G

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123940
SMART Domains Protein: ENSMUSP00000123015
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000131825
SMART Domains Protein: ENSMUSP00000119571
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000138785
AA Change: D146G

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121562
Gene: ENSMUSG00000000730
AA Change: D146G

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139539
SMART Domains Protein: ENSMUSP00000117827
Gene: ENSMUSG00000000730

DomainStartEndE-ValueType
PDB:2QRV|G 1 120 1e-38 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144446
Predicted Effect possibly damaging
Transcript: ENSMUST00000151242
AA Change: D146G

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116970
Gene: ENSMUSG00000000730
AA Change: D146G

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
PDB:2PVC|C 38 415 1e-163 PDB
SCOP:d1fp0a1 123 191 5e-3 SMART
Blast:RING 130 179 1e-18 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein that is a catalytically inactive regulatory factor of DNA methyltransferases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutants in this imprinted gene lack appropriate methylation of the maternal allele and this, in turn, causes azoospermia in homozygous males; and heterozygous progeny of homozygous females die by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dct A G 14: 118,013,188 V466A probably benign Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Dnmt3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dnmt3l APN 10 78057355 missense probably damaging 1.00
IGL00827:Dnmt3l APN 10 78053996 missense probably damaging 1.00
IGL01072:Dnmt3l APN 10 78052771 missense probably benign 0.09
IGL01118:Dnmt3l APN 10 78057286 missense probably damaging 0.97
IGL01553:Dnmt3l APN 10 78063248 missense probably benign 0.00
IGL02322:Dnmt3l APN 10 78052738 missense possibly damaging 0.90
IGL02323:Dnmt3l APN 10 78063318 missense probably damaging 1.00
IGL02618:Dnmt3l APN 10 78054022 splice site probably benign
IGL02701:Dnmt3l APN 10 78055022 missense probably benign 0.01
IGL02950:Dnmt3l APN 10 78050951 missense probably benign 0.01
R0318:Dnmt3l UTSW 10 78055055 missense probably damaging 1.00
R0384:Dnmt3l UTSW 10 78052737 missense possibly damaging 0.95
R0391:Dnmt3l UTSW 10 78051916 splice site probably benign
R1144:Dnmt3l UTSW 10 78051905 missense probably damaging 1.00
R2069:Dnmt3l UTSW 10 78052732 missense probably damaging 1.00
R2115:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R2116:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R2117:Dnmt3l UTSW 10 78063296 missense probably damaging 0.99
R4812:Dnmt3l UTSW 10 78057294 missense probably benign 0.06
R5001:Dnmt3l UTSW 10 78059731 missense probably null 1.00
R5039:Dnmt3l UTSW 10 78052900 splice site probably null
R5389:Dnmt3l UTSW 10 78056831 splice site probably null
R5799:Dnmt3l UTSW 10 78052026 missense possibly damaging 0.71
R5875:Dnmt3l UTSW 10 78053938 missense probably benign
R6314:Dnmt3l UTSW 10 78059687 missense probably benign 0.00
R6537:Dnmt3l UTSW 10 78052064 missense probably null 1.00
R8437:Dnmt3l UTSW 10 78052768 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGCCCCATGTAAGGTAAGTAG -3'
(R):5'- AATGAGCTGCCTATTCCCTG -3'

Sequencing Primer
(F):5'- TAAGTAGGGAGGTACTGGGACTGTC -3'
(R):5'- TGGACCCACCATATTGCTTAAG -3'
Posted On2016-12-15