Mutagenetix > Incidental Mutations

Incidental Mutation 'R5811:Dnmt3l'

447522

Institutional Source

Beutler Lab

Gene Symbol

Dnmt3l

Ensembl Gene

ENSMUSG00000000730

Gene Name

DNA (cytosine-5-)-methyltransferase 3-like

Synonyms

D6Ertd14e, ecat7

MMRRC Submission

043213-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5811 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78041947-78063622 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 78052095 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 146 (D146G)

Ref Sequence

ENSEMBL: ENSMUSP00000116970 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000746] [ENSMUST00000123940] [ENSMUST00000131825] [ENSMUST00000138785] [ENSMUST00000139539] [ENSMUST00000151242]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000746
AA Change: D146G

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000000746
Gene: ENSMUSG00000000730
AA Change: D146G

Domain	Start	End	E-Value	Type
low complexity region	22	32	N/A	INTRINSIC
PDB:2PVC\|C	38	415	1e-163	PDB
SCOP:d1fp0a1	123	191	5e-3	SMART
Blast:RING	130	179	1e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000123940

SMART Domains

Protein: ENSMUSP00000123015
Gene: ENSMUSG00000000730

Domain	Start	End	E-Value	Type
PDB:2QRV\|G	1	120	1e-38	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000131825

SMART Domains

Protein: ENSMUSP00000119571
Gene: ENSMUSG00000000730

Domain	Start	End	E-Value	Type
PDB:2QRV\|G	1	120	1e-38	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138785
AA Change: D146G

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000121562
Gene: ENSMUSG00000000730
AA Change: D146G

Domain	Start	End	E-Value	Type
low complexity region	22	32	N/A	INTRINSIC
PDB:2PVC\|C	38	415	1e-163	PDB
SCOP:d1fp0a1	123	191	5e-3	SMART
Blast:RING	130	179	1e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000139539

SMART Domains

Protein: ENSMUSP00000117827
Gene: ENSMUSG00000000730

Domain	Start	End	E-Value	Type
PDB:2QRV\|G	1	120	1e-38	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144446

Predicted Effect

possibly damaging
Transcript: ENSMUST00000151242
AA Change: D146G

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000116970
Gene: ENSMUSG00000000730
AA Change: D146G

Domain	Start	End	E-Value	Type
low complexity region	22	32	N/A	INTRINSIC
PDB:2PVC\|C	38	415	1e-163	PDB
SCOP:d1fp0a1	123	191	5e-3	SMART
Blast:RING	130	179	1e-18	BLAST

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein that is a catalytically inactive regulatory factor of DNA methyltransferases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutants in this imprinted gene lack appropriate methylation of the maternal allele and this, in turn, causes azoospermia in homozygous males; and heterozygous progeny of homozygous females die by midgestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Btnl1	A	T	17: 34,385,529	K428M	probably damaging	Het
Chid1	G	A	7: 141,530,253	T53M	probably damaging	Het
Clnk	A	G	5: 38,713,147	V356A	probably damaging	Het
Cryba4	C	T	5: 112,251,071	V36I	probably benign	Het
Dct	A	G	14: 118,013,188	V466A	probably benign	Het
Epas1	A	G	17: 86,823,775	N328D	probably damaging	Het
Fat4	C	T	3: 38,891,787	R1610W	probably damaging	Het
Filip1l	T	C	16: 57,570,294	V415A	probably damaging	Het
Garnl3	A	G	2: 33,006,899	L576P	probably damaging	Het
Gjd3	A	T	11: 98,982,400	V206E	possibly damaging	Het
Gpr135	A	T	12: 72,069,867	D375E	possibly damaging	Het
Gsdme	T	A	6: 50,245,945	Q130L	probably benign	Het
Hcls1	A	G	16: 36,957,340	M274V	probably null	Het
Kcnn4	T	C	7: 24,377,605	V193A	probably damaging	Het
Kctd16	T	C	18: 40,258,452	V31A	probably damaging	Het
Lamc2	C	T	1: 153,166,253	R45Q	possibly damaging	Het
Lrrc66	T	A	5: 73,615,517	I203F	possibly damaging	Het
Mark4	T	C	7: 19,448,639	D91G	probably damaging	Het
Mcm6	A	T	1: 128,335,728		probably benign	Het
Mecom	C	T	3: 29,961,000	S602N	probably benign	Het
Muc5ac	T	C	7: 141,798,984	V736A	possibly damaging	Het
Nr2e3	TCCATCGGAGTGTTCCC	TC	9: 59,943,418		probably benign	Het
Olfr92	C	A	17: 37,111,757	C75F	probably benign	Het
Pdia5	A	T	16: 35,449,420	M173K	possibly damaging	Het
Pih1d2	T	C	9: 50,621,074	L144P	probably damaging	Het
Plch2	C	T	4: 154,992,567	E577K	possibly damaging	Het
Samd4b	T	C	7: 28,408,020	S275G	probably damaging	Het
Sap130	T	C	18: 31,689,442	V668A	probably benign	Het
Sema3c	T	A	5: 17,675,190		probably null	Het
Slc9a8	C	T	2: 167,471,387	R390*	probably null	Het
Vmn2r89	A	T	14: 51,456,108	N305I	probably benign	Het
Wdr33	T	C	18: 31,902,620	F1164L	unknown	Het
Zfp873	T	A	10: 82,060,733	C470S	probably damaging	Het

Other mutations in Dnmt3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Dnmt3l	APN	10	78057355	missense	probably damaging	1.00
IGL00827:Dnmt3l	APN	10	78053996	missense	probably damaging	1.00
IGL01072:Dnmt3l	APN	10	78052771	missense	probably benign	0.09
IGL01118:Dnmt3l	APN	10	78057286	missense	probably damaging	0.97
IGL01553:Dnmt3l	APN	10	78063248	missense	probably benign	0.00
IGL02322:Dnmt3l	APN	10	78052738	missense	possibly damaging	0.90
IGL02323:Dnmt3l	APN	10	78063318	missense	probably damaging	1.00
IGL02618:Dnmt3l	APN	10	78054022	splice site	probably benign
IGL02701:Dnmt3l	APN	10	78055022	missense	probably benign	0.01
IGL02950:Dnmt3l	APN	10	78050951	missense	probably benign	0.01
R0318:Dnmt3l	UTSW	10	78055055	missense	probably damaging	1.00
R0384:Dnmt3l	UTSW	10	78052737	missense	possibly damaging	0.95
R0391:Dnmt3l	UTSW	10	78051916	splice site	probably benign
R1144:Dnmt3l	UTSW	10	78051905	missense	probably damaging	1.00
R2069:Dnmt3l	UTSW	10	78052732	missense	probably damaging	1.00
R2115:Dnmt3l	UTSW	10	78063296	missense	probably damaging	0.99
R2116:Dnmt3l	UTSW	10	78063296	missense	probably damaging	0.99
R2117:Dnmt3l	UTSW	10	78063296	missense	probably damaging	0.99
R4812:Dnmt3l	UTSW	10	78057294	missense	probably benign	0.06
R5001:Dnmt3l	UTSW	10	78059731	missense	probably null	1.00
R5039:Dnmt3l	UTSW	10	78052900	splice site	probably null
R5389:Dnmt3l	UTSW	10	78056831	splice site	probably null
R5799:Dnmt3l	UTSW	10	78052026	missense	possibly damaging	0.71
R5875:Dnmt3l	UTSW	10	78053938	missense	probably benign
R6314:Dnmt3l	UTSW	10	78059687	missense	probably benign	0.00
R6537:Dnmt3l	UTSW	10	78052064	missense	probably null	1.00
R8437:Dnmt3l	UTSW	10	78052768	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GTGCCCCATGTAAGGTAAGTAG -3'
(R):5'- AATGAGCTGCCTATTCCCTG -3'

Sequencing Primer
(F):5'- TAAGTAGGGAGGTACTGGGACTGTC -3'
(R):5'- TGGACCCACCATATTGCTTAAG -3'

Posted On

2016-12-15