Incidental Mutation 'R5811:Zfp873'
ID447523
Institutional Source Beutler Lab
Gene Symbol Zfp873
Ensembl Gene ENSMUSG00000061371
Gene Namezinc finger protein 873
Synonyms
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location82048123-82064745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82060733 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 470 (C470S)
Ref Sequence ENSEMBL: ENSMUSP00000148219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105313] [ENSMUST00000209622] [ENSMUST00000210325]
Predicted Effect probably damaging
Transcript: ENSMUST00000105313
AA Change: C433S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100950
Gene: ENSMUSG00000061371
AA Change: C433S

DomainStartEndE-ValueType
ZnF_C2H2 68 90 1.12e2 SMART
ZnF_C2H2 96 117 4.69e0 SMART
ZnF_C2H2 123 145 2.06e1 SMART
ZnF_C2H2 151 173 5.5e-3 SMART
ZnF_C2H2 179 201 3.69e-4 SMART
ZnF_C2H2 207 229 3.89e-3 SMART
ZnF_C2H2 235 257 9.88e-5 SMART
ZnF_C2H2 263 285 5.59e-4 SMART
ZnF_C2H2 291 313 2.99e-4 SMART
ZnF_C2H2 319 341 1.95e-3 SMART
ZnF_C2H2 347 369 2.75e-3 SMART
ZnF_C2H2 375 397 7.37e-4 SMART
ZnF_C2H2 403 425 2.53e-2 SMART
ZnF_C2H2 431 453 9.08e-4 SMART
ZnF_C2H2 459 481 5.99e-4 SMART
ZnF_C2H2 487 509 1.22e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.53e-2 SMART
ZnF_C2H2 571 593 9.73e-4 SMART
ZnF_C2H2 599 619 3.13e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209614
Predicted Effect probably benign
Transcript: ENSMUST00000209622
Predicted Effect probably damaging
Transcript: ENSMUST00000210325
AA Change: C470S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219748
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dct A G 14: 118,013,188 V466A probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Other mutations in Zfp873
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02250:Zfp873 APN 10 82058418 start codon destroyed probably null 0.45
G1Funyon:Zfp873 UTSW 10 82060879 missense probably damaging 1.00
R0666:Zfp873 UTSW 10 82060761 missense possibly damaging 0.75
R1568:Zfp873 UTSW 10 82060279 missense probably damaging 1.00
R1739:Zfp873 UTSW 10 82060707 missense probably damaging 1.00
R1848:Zfp873 UTSW 10 82060572 missense probably benign 0.33
R1892:Zfp873 UTSW 10 82061246 missense probably damaging 1.00
R2061:Zfp873 UTSW 10 82060157 missense probably benign 0.01
R3735:Zfp873 UTSW 10 82061181 missense probably benign 0.15
R4422:Zfp873 UTSW 10 82060874 missense probably benign 0.13
R4674:Zfp873 UTSW 10 82059980 missense possibly damaging 0.53
R4839:Zfp873 UTSW 10 82060519 missense probably damaging 0.98
R5146:Zfp873 UTSW 10 82060224 missense probably damaging 1.00
R5154:Zfp873 UTSW 10 82060191 missense possibly damaging 0.54
R5160:Zfp873 UTSW 10 82061042 missense possibly damaging 0.54
R6625:Zfp873 UTSW 10 82060304 missense probably damaging 1.00
R6667:Zfp873 UTSW 10 82060589 missense probably benign 0.22
R6742:Zfp873 UTSW 10 82058422 missense probably damaging 1.00
R6878:Zfp873 UTSW 10 82060695 missense probably benign 0.33
R7055:Zfp873 UTSW 10 82059998 missense probably damaging 1.00
R7296:Zfp873 UTSW 10 82061237 missense probably damaging 1.00
R7381:Zfp873 UTSW 10 82060971 missense probably damaging 1.00
R7448:Zfp873 UTSW 10 82060627 missense probably damaging 1.00
R7464:Zfp873 UTSW 10 82060376 missense possibly damaging 0.51
R7470:Zfp873 UTSW 10 82059939 missense probably benign 0.19
R7640:Zfp873 UTSW 10 82060275 missense possibly damaging 0.72
R7862:Zfp873 UTSW 10 82060275 missense probably benign 0.03
R8017:Zfp873 UTSW 10 82060359 missense probably benign 0.01
R8301:Zfp873 UTSW 10 82060879 missense probably damaging 1.00
R8765:Zfp873 UTSW 10 82060238 missense probably damaging 1.00
Z1177:Zfp873 UTSW 10 82061165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTATGAGTGTAGTCAGTGC -3'
(R):5'- CATCCATAGGGCTTCTCTCCAG -3'

Sequencing Primer
(F):5'- GAAACCCTATGATTGCAGTGACTGTG -3'
(R):5'- CGAAGGCTTTTCCACACTGATTACAG -3'
Posted On2016-12-15