Incidental Mutation 'R5811:Gpr135'
ID447525
Institutional Source Beutler Lab
Gene Symbol Gpr135
Ensembl Gene ENSMUSG00000043398
Gene NameG protein-coupled receptor 135
Synonyms
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location72067976-72071125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72069867 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 375 (D375E)
Ref Sequence ENSEMBL: ENSMUSP00000058762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019862] [ENSMUST00000050649]
Predicted Effect probably benign
Transcript: ENSMUST00000019862
SMART Domains Protein: ENSMUSP00000019862
Gene: ENSMUSG00000019718

DomainStartEndE-ValueType
Pfam:Pro_racemase 22 352 8.7e-122 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000050649
AA Change: D375E

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058762
Gene: ENSMUSG00000043398
AA Change: D375E

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
low complexity region 65 88 N/A INTRINSIC
Pfam:7tm_1 89 350 7.5e-43 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dct A G 14: 118,013,188 V466A probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Gpr135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Gpr135 APN 12 72069668 missense probably benign
IGL02059:Gpr135 APN 12 72070084 missense possibly damaging 0.87
IGL02219:Gpr135 APN 12 72070273 missense probably damaging 1.00
IGL02273:Gpr135 APN 12 72069958 missense probably damaging 0.96
R4688:Gpr135 UTSW 12 72070946 missense probably benign
R4791:Gpr135 UTSW 12 72069868 missense probably benign 0.12
R5001:Gpr135 UTSW 12 72070508 missense probably benign 0.10
R5857:Gpr135 UTSW 12 72070840 missense probably benign 0.25
R7604:Gpr135 UTSW 12 72069867 missense possibly damaging 0.87
R7708:Gpr135 UTSW 12 72069959 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCTCGGAAGAAGAGCACAAC -3'
(R):5'- CATGATTATCTTTGTCATGTGCTGC -3'

Sequencing Primer
(F):5'- GTTGGAAGAAGGCATCCT -3'
(R):5'- TGCTGGGGTCCCTACTG -3'
Posted On2016-12-15