Incidental Mutation 'R5811:Dct'
ID447527
Institutional Source Beutler Lab
Gene Symbol Dct
Ensembl Gene ENSMUSG00000022129
Gene Namedopachrome tautomerase
SynonymsTRP-2, Tyrp2, tyrosinase-related protein-2, TRP2, Tyrp-2
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location118012790-118052244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118013188 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 466 (V466A)
Ref Sequence ENSEMBL: ENSMUSP00000022725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022725]
Predicted Effect probably benign
Transcript: ENSMUST00000022725
AA Change: V466A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022725
Gene: ENSMUSG00000022129
AA Change: V466A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Blast:EGF 90 118 4e-6 BLAST
Pfam:Tyrosinase 179 409 1.2e-35 PFAM
transmembrane domain 469 491 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this melanocyte protein gene cause coat color dilution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Dct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Dct APN 14 118040504 missense probably damaging 1.00
IGL01399:Dct APN 14 118036478 missense probably damaging 0.99
IGL01995:Dct APN 14 118034243 missense probably damaging 0.96
R0589:Dct UTSW 14 118043270 missense probably benign 0.17
R1101:Dct UTSW 14 118036622 missense probably damaging 1.00
R1665:Dct UTSW 14 118034251 missense probably damaging 1.00
R1823:Dct UTSW 14 118036523 missense probably benign 0.20
R1902:Dct UTSW 14 118034278 missense probably benign 0.00
R1903:Dct UTSW 14 118034278 missense probably benign 0.00
R1985:Dct UTSW 14 118036542 missense probably benign 0.11
R2210:Dct UTSW 14 118043149 missense probably benign
R6025:Dct UTSW 14 118036464 missense possibly damaging 0.52
R7974:Dct UTSW 14 118039655 missense probably damaging 1.00
R8401:Dct UTSW 14 118043203 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGTCTCAAGATGAGCGACGG -3'
(R):5'- ACAGTTGTGGTTAGGGTAACAG -3'

Sequencing Primer
(F):5'- GCGACGGTGTAATTAGTTACTACCC -3'
(R):5'- TTGTGGTTAGGGTAACAGCGAGAAG -3'
Posted On2016-12-15