Incidental Mutation 'R5811:Hcls1'
ID447531
Institutional Source Beutler Lab
Gene Symbol Hcls1
Ensembl Gene ENSMUSG00000022831
Gene Namehematopoietic cell specific Lyn substrate 1
SynonymsHS1
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location36934983-36963212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36957340 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 274 (M274V)
Ref Sequence ENSEMBL: ENSMUSP00000023531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023531] [ENSMUST00000164050]
Predicted Effect probably null
Transcript: ENSMUST00000023531
AA Change: M274V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023531
Gene: ENSMUSG00000022831
AA Change: M274V

DomainStartEndE-ValueType
Pfam:HS1_rep 82 117 6.6e-23 PFAM
Pfam:HS1_rep 119 154 1.2e-23 PFAM
Pfam:HS1_rep 156 191 3.3e-21 PFAM
Pfam:HS1_rep 193 220 2.1e-14 PFAM
coiled coil region 238 273 N/A INTRINSIC
low complexity region 358 390 N/A INTRINSIC
SH3 432 486 1.2e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163755
Predicted Effect probably benign
Transcript: ENSMUST00000164050
SMART Domains Protein: ENSMUSP00000127186
Gene: ENSMUSG00000022831

DomainStartEndE-ValueType
Pfam:HS1_rep 82 118 6e-24 PFAM
Pfam:HS1_rep 119 136 1.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show impaired antibody production to T-independent antigen and impaired proliferative responses of splenic B and T cells after cross-linking of antigen receptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dct A G 14: 118,013,188 V466A probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Hcls1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Hcls1 APN 16 36956021 critical splice donor site probably null
IGL01022:Hcls1 APN 16 36951126 intron probably benign
IGL02838:Hcls1 APN 16 36962419 missense probably damaging 1.00
R0125:Hcls1 UTSW 16 36962163 missense probably benign 0.14
R0137:Hcls1 UTSW 16 36951174 missense probably damaging 0.99
R0230:Hcls1 UTSW 16 36937854 missense probably damaging 1.00
R0614:Hcls1 UTSW 16 36962625 missense probably damaging 1.00
R1897:Hcls1 UTSW 16 36962643 missense probably damaging 1.00
R2246:Hcls1 UTSW 16 36962622 missense probably damaging 0.97
R4037:Hcls1 UTSW 16 36956625 missense possibly damaging 0.74
R4397:Hcls1 UTSW 16 36937300 missense possibly damaging 0.50
R4777:Hcls1 UTSW 16 36955316 missense probably damaging 1.00
R4978:Hcls1 UTSW 16 36937860 missense probably damaging 1.00
R5432:Hcls1 UTSW 16 36961548 missense probably benign
R6601:Hcls1 UTSW 16 36962386 missense probably benign 0.00
R7794:Hcls1 UTSW 16 36962064 missense probably damaging 1.00
R8040:Hcls1 UTSW 16 36951149 missense probably damaging 0.97
R8439:Hcls1 UTSW 16 36946641 missense probably benign 0.14
R8688:Hcls1 UTSW 16 36961459 missense probably benign
R8782:Hcls1 UTSW 16 36957301 missense probably benign
Z1176:Hcls1 UTSW 16 36961492 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CGCTCATTTATACAAGTACCATTCC -3'
(R):5'- AAGAAATGCATCTGCCCTATCTATC -3'

Sequencing Primer
(F):5'- TCTCTCCACTCAAGATCCCGG -3'
(R):5'- GCATCTGCCCTATCTATCTATCTATC -3'
Posted On2016-12-15