Incidental Mutation 'R5811:Btnl1'
ID447533
Institutional Source Beutler Lab
Gene Symbol Btnl1
Ensembl Gene ENSMUSG00000062638
Gene Namebutyrophilin-like 1
SynonymsBtnl3, LOC240074, LOC240074, NG10
MMRRC Submission 043213-MU
Accession Numbers

Genbank: NM_001111094; MGI: 1932027

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34377132-34385776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34385529 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 428 (K428M)
Ref Sequence ENSEMBL: ENSMUSP00000079140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080254]
Predicted Effect probably damaging
Transcript: ENSMUST00000080254
AA Change: K428M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079140
Gene: ENSMUSG00000062638
AA Change: K428M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 48 129 1.28e-10 SMART
Blast:IG_like 153 223 1e-26 BLAST
transmembrane domain 249 271 N/A INTRINSIC
Pfam:SPRY 389 506 1.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dct A G 14: 118,013,188 V466A probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Btnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Btnl1 APN 17 34381117 missense probably damaging 1.00
IGL01743:Btnl1 APN 17 34385685 missense probably damaging 1.00
IGL02194:Btnl1 APN 17 34379535 missense possibly damaging 0.90
IGL02329:Btnl1 APN 17 34382265 missense possibly damaging 0.85
IGL03275:Btnl1 APN 17 34385512 missense probably damaging 0.99
3-1:Btnl1 UTSW 17 34381056 missense probably damaging 1.00
R0021:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R0021:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R0371:Btnl1 UTSW 17 34381057 missense probably damaging 0.99
R1689:Btnl1 UTSW 17 34381208 nonsense probably null
R1982:Btnl1 UTSW 17 34379751 missense possibly damaging 0.81
R2109:Btnl1 UTSW 17 34379604 missense probably damaging 1.00
R2134:Btnl1 UTSW 17 34385634 missense possibly damaging 0.48
R2760:Btnl1 UTSW 17 34381038 missense probably damaging 1.00
R4084:Btnl1 UTSW 17 34381159 missense possibly damaging 0.91
R4586:Btnl1 UTSW 17 34382462 missense probably damaging 1.00
R4611:Btnl1 UTSW 17 34379725 missense probably damaging 0.99
R4625:Btnl1 UTSW 17 34379751 missense probably null 0.99
R5579:Btnl1 UTSW 17 34381552 critical splice donor site probably null
R6380:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R6602:Btnl1 UTSW 17 34385748 missense probably damaging 0.99
R6633:Btnl1 UTSW 17 34385331 missense possibly damaging 0.86
R8134:Btnl1 UTSW 17 34385673 missense possibly damaging 0.86
R8136:Btnl1 UTSW 17 34380040 splice site probably null
R8840:Btnl1 UTSW 17 34385603 missense probably benign 0.17
RF041:Btnl1 UTSW 17 34381368 missense probably benign 0.04
X0026:Btnl1 UTSW 17 34377932 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCAGCAGCTCACAAGTAGAC -3'
(R):5'- CCCCATGGAATTACGTGTGAAG -3'

Sequencing Primer
(F):5'- GTAGACCACAACCTCATCACACTCTC -3'
(R):5'- CCCATGGAATTACGTGTGAAGTAAGG -3'
Posted On2016-12-15