Incidental Mutation 'R5811:Olfr92'
ID447534
Institutional Source Beutler Lab
Gene Symbol Olfr92
Ensembl Gene ENSMUSG00000096477
Gene Nameolfactory receptor 92
SynonymsMOR256-29, GA_x6K02T2PSCP-1552066-1551128
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37110512-37120088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37111757 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 75 (C75F)
Ref Sequence ENSEMBL: ENSMUSP00000150988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168659] [ENSMUST00000214994] [ENSMUST00000216341]
Predicted Effect probably benign
Transcript: ENSMUST00000168659
AA Change: C75F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000128393
Gene: ENSMUSG00000096477
AA Change: C75F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 304 5.1e-7 PFAM
Pfam:7tm_4 29 306 3.4e-50 PFAM
Pfam:7tm_1 39 288 1.1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174626
Predicted Effect probably benign
Transcript: ENSMUST00000214994
AA Change: C75F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000216341
AA Change: C75F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dct A G 14: 118,013,188 V466A probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Epas1 A G 17: 86,823,775 N328D probably damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Olfr92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr92 APN 17 37111809 missense probably damaging 1.00
IGL02850:Olfr92 APN 17 37111973 missense probably benign 0.35
IGL03209:Olfr92 APN 17 37111521 missense probably benign 0.04
R0579:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0580:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0582:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0615:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0669:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0674:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0675:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R2424:Olfr92 UTSW 17 37111516 missense probably benign 0.02
R3714:Olfr92 UTSW 17 37111335 missense probably damaging 1.00
R4393:Olfr92 UTSW 17 37114084 intron probably benign
R6615:Olfr92 UTSW 17 37111602 missense probably damaging 1.00
R6853:Olfr92 UTSW 17 37111508 missense probably benign 0.02
R6876:Olfr92 UTSW 17 37111206 missense probably damaging 1.00
R7665:Olfr92 UTSW 17 37111391 missense probably benign 0.20
R8087:Olfr92 UTSW 17 37111548 missense probably benign
Z1177:Olfr92 UTSW 17 37111430 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCAAGCTATACCTGCCAACTGG -3'
(R):5'- TGCTGGGCTTCTCTGACAAC -3'

Sequencing Primer
(F):5'- CCAACTGGCGACATAGGTG -3'
(R):5'- CCCACAACTGGAAAAGGTTCTG -3'
Posted On2016-12-15