Incidental Mutation 'R5811:Epas1'
ID447535
Institutional Source Beutler Lab
Gene Symbol Epas1
Ensembl Gene ENSMUSG00000024140
Gene Nameendothelial PAS domain protein 1
SynonymsHIF-2alpha, HRF, HLF, bHLHe73, hypoxia inducible transcription factor 2alpha, HIF2A, MOP2, Hif like protein
MMRRC Submission 043213-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5811 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location86753907-86833410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86823775 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 328 (N328D)
Ref Sequence ENSEMBL: ENSMUSP00000024954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024954]
Predicted Effect probably damaging
Transcript: ENSMUST00000024954
AA Change: N328D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024954
Gene: ENSMUSG00000024140
AA Change: N328D

DomainStartEndE-ValueType
HLH 20 75 3.98e-9 SMART
PAS 86 152 6.39e-9 SMART
PAS 232 298 6.75e-8 SMART
PAC 304 347 5.56e-9 SMART
low complexity region 464 484 N/A INTRINSIC
Pfam:HIF-1 516 548 4.9e-21 PFAM
low complexity region 725 737 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
Pfam:HIF-1a_CTAD 837 873 3.6e-23 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor involved in the induction of genes regulated by oxygen, which is induced as oxygen levels fall. The encoded protein contains a basic-helix-loop-helix domain protein dimerization domain as well as a domain found in proteins in signal transduction pathways which respond to oxygen levels. Mutations in this gene are associated with erythrocytosis familial type 4. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for null mutations display prenatal, neonatal or postnatal lethality. For some alleles lethality is associated with vascular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btnl1 A T 17: 34,385,529 K428M probably damaging Het
Chid1 G A 7: 141,530,253 T53M probably damaging Het
Clnk A G 5: 38,713,147 V356A probably damaging Het
Cryba4 C T 5: 112,251,071 V36I probably benign Het
Dct A G 14: 118,013,188 V466A probably benign Het
Dnmt3l A G 10: 78,052,095 D146G possibly damaging Het
Fat4 C T 3: 38,891,787 R1610W probably damaging Het
Filip1l T C 16: 57,570,294 V415A probably damaging Het
Garnl3 A G 2: 33,006,899 L576P probably damaging Het
Gjd3 A T 11: 98,982,400 V206E possibly damaging Het
Gpr135 A T 12: 72,069,867 D375E possibly damaging Het
Gsdme T A 6: 50,245,945 Q130L probably benign Het
Hcls1 A G 16: 36,957,340 M274V probably null Het
Kcnn4 T C 7: 24,377,605 V193A probably damaging Het
Kctd16 T C 18: 40,258,452 V31A probably damaging Het
Lamc2 C T 1: 153,166,253 R45Q possibly damaging Het
Lrrc66 T A 5: 73,615,517 I203F possibly damaging Het
Mark4 T C 7: 19,448,639 D91G probably damaging Het
Mcm6 A T 1: 128,335,728 probably benign Het
Mecom C T 3: 29,961,000 S602N probably benign Het
Muc5ac T C 7: 141,798,984 V736A possibly damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr92 C A 17: 37,111,757 C75F probably benign Het
Pdia5 A T 16: 35,449,420 M173K possibly damaging Het
Pih1d2 T C 9: 50,621,074 L144P probably damaging Het
Plch2 C T 4: 154,992,567 E577K possibly damaging Het
Samd4b T C 7: 28,408,020 S275G probably damaging Het
Sap130 T C 18: 31,689,442 V668A probably benign Het
Sema3c T A 5: 17,675,190 probably null Het
Slc9a8 C T 2: 167,471,387 R390* probably null Het
Vmn2r89 A T 14: 51,456,108 N305I probably benign Het
Wdr33 T C 18: 31,902,620 F1164L unknown Het
Zfp873 T A 10: 82,060,733 C470S probably damaging Het
Other mutations in Epas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Epas1 APN 17 86823729 missense probably damaging 1.00
IGL02150:Epas1 APN 17 86805289 missense probably damaging 1.00
IGL02221:Epas1 APN 17 86827847 missense possibly damaging 0.50
IGL02555:Epas1 APN 17 86829064 missense probably benign
IGL02739:Epas1 APN 17 86805282 missense probably damaging 0.98
IGL03389:Epas1 APN 17 86823703 missense probably benign 0.10
R0043:Epas1 UTSW 17 86823812 missense probably damaging 0.99
R0363:Epas1 UTSW 17 86805848 splice site probably benign
R0399:Epas1 UTSW 17 86805193 missense probably benign 0.01
R0737:Epas1 UTSW 17 86829456 missense possibly damaging 0.45
R1542:Epas1 UTSW 17 86824490 missense possibly damaging 0.67
R1662:Epas1 UTSW 17 86829027 missense probably damaging 0.99
R1885:Epas1 UTSW 17 86805295 missense probably damaging 1.00
R2197:Epas1 UTSW 17 86829043 missense probably benign 0.01
R3056:Epas1 UTSW 17 86830981 missense probably damaging 0.99
R4342:Epas1 UTSW 17 86823800 missense probably damaging 1.00
R4391:Epas1 UTSW 17 86809663 missense probably benign 0.00
R4774:Epas1 UTSW 17 86805758 missense probably damaging 1.00
R4798:Epas1 UTSW 17 86805839 missense probably benign
R4989:Epas1 UTSW 17 86809454 missense probably damaging 1.00
R5133:Epas1 UTSW 17 86809454 missense probably damaging 1.00
R5604:Epas1 UTSW 17 86805772 missense probably damaging 1.00
R5838:Epas1 UTSW 17 86823686 missense possibly damaging 0.94
R5885:Epas1 UTSW 17 86827544 missense probably damaging 1.00
R5932:Epas1 UTSW 17 86827646 missense possibly damaging 0.66
R6045:Epas1 UTSW 17 86809399 missense probably damaging 0.99
R6145:Epas1 UTSW 17 86829429 missense probably benign 0.01
R7517:Epas1 UTSW 17 86831098 missense possibly damaging 0.92
R7552:Epas1 UTSW 17 86829043 missense probably benign 0.01
R7828:Epas1 UTSW 17 86827699 missense probably benign 0.04
R8081:Epas1 UTSW 17 86829369 missense probably benign
R8111:Epas1 UTSW 17 86818432 nonsense probably null
R8558:Epas1 UTSW 17 86809468 missense possibly damaging 0.89
Z1176:Epas1 UTSW 17 86827946 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ATCTGGCAGCTCTGTCCATC -3'
(R):5'- AGAGACATGATACCATAGCTGAC -3'

Sequencing Primer
(F):5'- GGGCAGGTGACACTTCCTG -3'
(R):5'- GAAACACGCTAGAGCTCTGTTC -3'
Posted On2016-12-15