Mutagenetix > Incidental Mutation

Incidental Mutation 'R5811:Epas1'

447535

Institutional Source

Beutler Lab

Gene Symbol

Epas1

Ensembl Gene

ENSMUSG00000024140

Gene Name

endothelial PAS domain protein 1

Synonyms

HIF-2alpha, HRF, HLF, bHLHe73, hypoxia inducible transcription factor 2alpha, HIF2A, MOP2, Hif like protein

MMRRC Submission

043213-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5811 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86753907-86833410 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86823775 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 328 (N328D)

Ref Sequence

ENSEMBL: ENSMUSP00000024954 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024954]

AlphaFold

P97481

Predicted Effect

probably damaging
Transcript: ENSMUST00000024954
AA Change: N328D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000024954
Gene: ENSMUSG00000024140
AA Change: N328D

Domain	Start	End	E-Value	Type
HLH	20	75	3.98e-9	SMART
PAS	86	152	6.39e-9	SMART
PAS	232	298	6.75e-8	SMART
PAC	304	347	5.56e-9	SMART
low complexity region	464	484	N/A	INTRINSIC
Pfam:HIF-1	516	548	4.9e-21	PFAM
low complexity region	725	737	N/A	INTRINSIC
low complexity region	775	796	N/A	INTRINSIC
Pfam:HIF-1a_CTAD	837	873	3.6e-23	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor involved in the induction of genes regulated by oxygen, which is induced as oxygen levels fall. The encoded protein contains a basic-helix-loop-helix domain protein dimerization domain as well as a domain found in proteins in signal transduction pathways which respond to oxygen levels. Mutations in this gene are associated with erythrocytosis familial type 4. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for null mutations display prenatal, neonatal or postnatal lethality. For some alleles lethality is associated with vascular abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Btnl1	A	T	17: 34,385,529	K428M	probably damaging	Het
Chid1	G	A	7: 141,530,253	T53M	probably damaging	Het
Clnk	A	G	5: 38,713,147	V356A	probably damaging	Het
Cryba4	C	T	5: 112,251,071	V36I	probably benign	Het
Dct	A	G	14: 118,013,188	V466A	probably benign	Het
Dnmt3l	A	G	10: 78,052,095	D146G	possibly damaging	Het
Fat4	C	T	3: 38,891,787	R1610W	probably damaging	Het
Filip1l	T	C	16: 57,570,294	V415A	probably damaging	Het
Garnl3	A	G	2: 33,006,899	L576P	probably damaging	Het
Gjd3	A	T	11: 98,982,400	V206E	possibly damaging	Het
Gpr135	A	T	12: 72,069,867	D375E	possibly damaging	Het
Gsdme	T	A	6: 50,245,945	Q130L	probably benign	Het
Hcls1	A	G	16: 36,957,340	M274V	probably null	Het
Kcnn4	T	C	7: 24,377,605	V193A	probably damaging	Het
Kctd16	T	C	18: 40,258,452	V31A	probably damaging	Het
Lamc2	C	T	1: 153,166,253	R45Q	possibly damaging	Het
Lrrc66	T	A	5: 73,615,517	I203F	possibly damaging	Het
Mark4	T	C	7: 19,448,639	D91G	probably damaging	Het
Mcm6	A	T	1: 128,335,728		probably benign	Het
Mecom	C	T	3: 29,961,000	S602N	probably benign	Het
Muc5ac	T	C	7: 141,798,984	V736A	possibly damaging	Het
Nr2e3	TCCATCGGAGTGTTCCC	TC	9: 59,943,418		probably benign	Het
Olfr92	C	A	17: 37,111,757	C75F	probably benign	Het
Pdia5	A	T	16: 35,449,420	M173K	possibly damaging	Het
Pih1d2	T	C	9: 50,621,074	L144P	probably damaging	Het
Plch2	C	T	4: 154,992,567	E577K	possibly damaging	Het
Samd4b	T	C	7: 28,408,020	S275G	probably damaging	Het
Sap130	T	C	18: 31,689,442	V668A	probably benign	Het
Sema3c	T	A	5: 17,675,190		probably null	Het
Slc9a8	C	T	2: 167,471,387	R390*	probably null	Het
Vmn2r89	A	T	14: 51,456,108	N305I	probably benign	Het
Wdr33	T	C	18: 31,902,620	F1164L	unknown	Het
Zfp873	T	A	10: 82,060,733	C470S	probably damaging	Het

Other mutations in Epas1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01934:Epas1	APN	17	86823729	missense	probably damaging	1.00
IGL02150:Epas1	APN	17	86805289	missense	probably damaging	1.00
IGL02221:Epas1	APN	17	86827847	missense	possibly damaging	0.50
IGL02555:Epas1	APN	17	86829064	missense	probably benign
IGL02739:Epas1	APN	17	86805282	missense	probably damaging	0.98
IGL03389:Epas1	APN	17	86823703	missense	probably benign	0.10
R0043:Epas1	UTSW	17	86823812	missense	probably damaging	0.99
R0363:Epas1	UTSW	17	86805848	splice site	probably benign
R0399:Epas1	UTSW	17	86805193	missense	probably benign	0.01
R0737:Epas1	UTSW	17	86829456	missense	possibly damaging	0.45
R1542:Epas1	UTSW	17	86824490	missense	possibly damaging	0.67
R1662:Epas1	UTSW	17	86829027	missense	probably damaging	0.99
R1885:Epas1	UTSW	17	86805295	missense	probably damaging	1.00
R2197:Epas1	UTSW	17	86829043	missense	probably benign	0.01
R3056:Epas1	UTSW	17	86830981	missense	probably damaging	0.99
R4342:Epas1	UTSW	17	86823800	missense	probably damaging	1.00
R4391:Epas1	UTSW	17	86809663	missense	probably benign	0.00
R4774:Epas1	UTSW	17	86805758	missense	probably damaging	1.00
R4798:Epas1	UTSW	17	86805839	missense	probably benign
R4989:Epas1	UTSW	17	86809454	missense	probably damaging	1.00
R5133:Epas1	UTSW	17	86809454	missense	probably damaging	1.00
R5604:Epas1	UTSW	17	86805772	missense	probably damaging	1.00
R5838:Epas1	UTSW	17	86823686	missense	possibly damaging	0.94
R5885:Epas1	UTSW	17	86827544	missense	probably damaging	1.00
R5932:Epas1	UTSW	17	86827646	missense	possibly damaging	0.66
R6045:Epas1	UTSW	17	86809399	missense	probably damaging	0.99
R6145:Epas1	UTSW	17	86829429	missense	probably benign	0.01
R7517:Epas1	UTSW	17	86831098	missense	possibly damaging	0.92
R7552:Epas1	UTSW	17	86829043	missense	probably benign	0.01
R7828:Epas1	UTSW	17	86827699	missense	probably benign	0.04
R8081:Epas1	UTSW	17	86829369	missense	probably benign
R8111:Epas1	UTSW	17	86818432	nonsense	probably null
R8558:Epas1	UTSW	17	86809468	missense	possibly damaging	0.89
R8948:Epas1	UTSW	17	86827492	missense	probably benign	0.01
R9074:Epas1	UTSW	17	86827839	missense	probably benign	0.41
R9204:Epas1	UTSW	17	86809445	missense	probably damaging	1.00
R9228:Epas1	UTSW	17	86826562	missense	possibly damaging	0.71
R9319:Epas1	UTSW	17	86797117	missense	possibly damaging	0.88
R9562:Epas1	UTSW	17	86805239	missense	probably damaging	1.00
R9565:Epas1	UTSW	17	86805239	missense	probably damaging	1.00
R9607:Epas1	UTSW	17	86826610	missense	probably benign	0.04
Z1176:Epas1	UTSW	17	86827946	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- ATCTGGCAGCTCTGTCCATC -3'
(R):5'- AGAGACATGATACCATAGCTGAC -3'

Sequencing Primer
(F):5'- GGGCAGGTGACACTTCCTG -3'
(R):5'- GAAACACGCTAGAGCTCTGTTC -3'

Posted On

2016-12-15