Incidental Mutation 'R5812:March4'
ID447539
Institutional Source Beutler Lab
Gene Symbol March4
Ensembl Gene ENSMUSG00000039372
Gene Namemembrane-associated ring finger (C3HC4) 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R5812 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location72427112-72536930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72428917 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 319 (T319A)
Ref Sequence ENSEMBL: ENSMUSP00000042803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047786]
Predicted Effect probably benign
Transcript: ENSMUST00000047786
AA Change: T319A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042803
Gene: ENSMUSG00000039372
AA Change: T319A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 79 94 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 125 135 N/A INTRINSIC
RINGv 161 208 3.5e-18 SMART
transmembrane domain 235 257 N/A INTRINSIC
Blast:AAA 263 290 4e-9 BLAST
low complexity region 344 360 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH4 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH4 reduces surface accumulation of several membrane glycoproteins by directing them to the endosomal compartment (Bartee et al., 2004 [PubMed 14722266]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,176,538 S9P probably damaging Het
Acsl5 G A 19: 55,294,836 V615I probably benign Het
Ankk1 T C 9: 49,426,853 K47E probably benign Het
Ankrd11 A T 8: 122,893,805 probably null Het
Bcl9l T C 9: 44,506,644 V593A probably benign Het
Cadps T C 14: 12,376,685 I1271V probably benign Het
Ccdc125 T C 13: 100,684,304 W152R probably damaging Het
Cep192 T C 18: 67,851,737 V1606A possibly damaging Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cxxc5 T A 18: 35,859,056 V170E probably damaging Het
Defb6 C T 8: 19,228,094 R61C possibly damaging Het
Dnah10 T A 5: 124,747,746 N655K probably benign Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Gli1 C T 10: 127,337,415 G125S probably damaging Het
Gm5538 T A 3: 59,747,272 Y176N probably damaging Het
Igkv14-126 A T 6: 67,896,440 I51F possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jtb T C 3: 90,233,977 S87P probably benign Het
Kdm6b A T 11: 69,405,929 I504N probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Nt5e T C 9: 88,369,055 V459A probably damaging Het
Ogdhl A G 14: 32,332,865 K257E probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr117 A G 17: 37,659,739 L198P probably damaging Het
Osmr A T 15: 6,837,059 V378D probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pdzd7 G T 19: 45,036,871 T395K probably damaging Het
Rasgef1c A G 11: 49,957,143 D35G probably benign Het
Rbm19 T C 5: 120,141,577 F770L probably damaging Het
Rit2 C A 18: 30,975,461 C157F probably damaging Het
Slc22a22 A G 15: 57,256,473 probably null Het
Slc8b1 T C 5: 120,513,338 probably null Het
Speer2 C A 16: 69,858,895 R14S possibly damaging Het
Tas2r105 C A 6: 131,686,873 L197F possibly damaging Het
Tmprss11b T A 5: 86,665,098 H113L possibly damaging Het
Ttbk2 G A 2: 120,822,559 P64S probably damaging Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vps13c T A 9: 67,982,495 probably benign Het
Zbtb39 T A 10: 127,741,560 M1K probably null Het
Other mutations in March4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:March4 APN 1 72452531 nonsense probably null
IGL02996:March4 APN 1 72428899 nonsense probably null
R0245:March4 UTSW 1 72534781 missense probably benign 0.00
R2865:March4 UTSW 1 72452575 missense probably damaging 1.00
R4386:March4 UTSW 1 72428814 missense probably benign 0.00
R4917:March4 UTSW 1 72428779 missense probably benign 0.27
R4918:March4 UTSW 1 72428779 missense probably benign 0.27
R6266:March4 UTSW 1 72452488 missense probably damaging 1.00
R7247:March4 UTSW 1 72452478 nonsense probably null
R7619:March4 UTSW 1 72534989 missense possibly damaging 0.89
R7643:March4 UTSW 1 72447220 missense probably damaging 1.00
R8176:March4 UTSW 1 72534839 missense probably damaging 0.96
Z1176:March4 UTSW 1 72452500 missense probably damaging 1.00
Z1177:March4 UTSW 1 72428957 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTCAAGTGACTCAGGATGTG -3'
(R):5'- AGTGCCCGTGTCTGTGTAAG -3'

Sequencing Primer
(F):5'- TCAAGTGACTCAGGATGTGTAGGATG -3'
(R):5'- GCCCGTGTCTGTGTAAGTTAAG -3'
Posted On2016-12-15