Incidental Mutation 'R5812:Gm5538'
ID447543
Institutional Source Beutler Lab
Gene Symbol Gm5538
Ensembl Gene ENSMUSG00000090527
Gene Namepredicted gene 5538
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5812 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location59729790-59752333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59747272 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 176 (Y176N)
Ref Sequence ENSEMBL: ENSMUSP00000128877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168156]
Predicted Effect probably damaging
Transcript: ENSMUST00000168156
AA Change: Y176N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128877
Gene: ENSMUSG00000090527
AA Change: Y176N

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:DUF2424 70 214 9.3e-9 PFAM
Pfam:COesterase 91 236 5.4e-10 PFAM
Pfam:Abhydrolase_3 107 287 6.6e-36 PFAM
Pfam:Abhydrolase_3 271 375 1.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,176,538 S9P probably damaging Het
Acsl5 G A 19: 55,294,836 V615I probably benign Het
Ankk1 T C 9: 49,426,853 K47E probably benign Het
Ankrd11 A T 8: 122,893,805 probably null Het
Bcl9l T C 9: 44,506,644 V593A probably benign Het
Cadps T C 14: 12,376,685 I1271V probably benign Het
Ccdc125 T C 13: 100,684,304 W152R probably damaging Het
Cep192 T C 18: 67,851,737 V1606A possibly damaging Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cxxc5 T A 18: 35,859,056 V170E probably damaging Het
Defb6 C T 8: 19,228,094 R61C possibly damaging Het
Dnah10 T A 5: 124,747,746 N655K probably benign Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Gli1 C T 10: 127,337,415 G125S probably damaging Het
Igkv14-126 A T 6: 67,896,440 I51F possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jtb T C 3: 90,233,977 S87P probably benign Het
Kdm6b A T 11: 69,405,929 I504N probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
March4 T C 1: 72,428,917 T319A probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Nt5e T C 9: 88,369,055 V459A probably damaging Het
Ogdhl A G 14: 32,332,865 K257E probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr117 A G 17: 37,659,739 L198P probably damaging Het
Osmr A T 15: 6,837,059 V378D probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pdzd7 G T 19: 45,036,871 T395K probably damaging Het
Rasgef1c A G 11: 49,957,143 D35G probably benign Het
Rbm19 T C 5: 120,141,577 F770L probably damaging Het
Rit2 C A 18: 30,975,461 C157F probably damaging Het
Slc22a22 A G 15: 57,256,473 probably null Het
Slc8b1 T C 5: 120,513,338 probably null Het
Speer2 C A 16: 69,858,895 R14S possibly damaging Het
Tas2r105 C A 6: 131,686,873 L197F possibly damaging Het
Tmprss11b T A 5: 86,665,098 H113L possibly damaging Het
Ttbk2 G A 2: 120,822,559 P64S probably damaging Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vps13c T A 9: 67,982,495 probably benign Het
Zbtb39 T A 10: 127,741,560 M1K probably null Het
Other mutations in Gm5538
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Gm5538 APN 3 59752121 missense possibly damaging 0.91
IGL00934:Gm5538 APN 3 59752053 missense probably benign 0.00
IGL02335:Gm5538 APN 3 59743605 missense probably benign
IGL02709:Gm5538 APN 3 59747198 missense probably damaging 1.00
IGL03114:Gm5538 APN 3 59743723 missense possibly damaging 0.55
R0107:Gm5538 UTSW 3 59752316 missense possibly damaging 0.78
R0591:Gm5538 UTSW 3 59752129 nonsense probably null
R0850:Gm5538 UTSW 3 59752248 missense possibly damaging 0.80
R1127:Gm5538 UTSW 3 59751893 missense probably benign 0.00
R1916:Gm5538 UTSW 3 59745503 missense possibly damaging 0.48
R3008:Gm5538 UTSW 3 59745509 missense possibly damaging 0.93
R3921:Gm5538 UTSW 3 59752077 missense probably damaging 0.98
R4368:Gm5538 UTSW 3 59751966 missense probably damaging 1.00
R5240:Gm5538 UTSW 3 59752028 missense probably damaging 0.99
R5268:Gm5538 UTSW 3 59752023 missense probably damaging 0.99
R5511:Gm5538 UTSW 3 59747264 missense probably damaging 1.00
R5564:Gm5538 UTSW 3 59752092 missense probably benign
R5981:Gm5538 UTSW 3 59751878 missense probably benign
R6049:Gm5538 UTSW 3 59752149 missense probably damaging 1.00
R6195:Gm5538 UTSW 3 59752202 missense probably damaging 0.98
R6353:Gm5538 UTSW 3 59752108 missense probably damaging 1.00
R6449:Gm5538 UTSW 3 59745551 missense probably damaging 1.00
R6845:Gm5538 UTSW 3 59752118 missense probably damaging 1.00
R7382:Gm5538 UTSW 3 59743616 missense probably benign 0.18
R7585:Gm5538 UTSW 3 59743722 missense possibly damaging 0.94
R7827:Gm5538 UTSW 3 59743691 missense probably damaging 0.99
R7844:Gm5538 UTSW 3 59729897 missense probably benign 0.32
R8308:Gm5538 UTSW 3 59752149 missense probably damaging 1.00
Z1176:Gm5538 UTSW 3 59747194 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTCTCTTACTCATCAATAGGTCCAG -3'
(R):5'- AGGAGAAAGCCTGTTAGCAC -3'

Sequencing Primer
(F):5'- GCTTCTTGCTTTAAAACAGAAGC -3'
(R):5'- CTGTTAGCACAGGAGCAGTG -3'
Posted On2016-12-15