Incidental Mutation 'R5812:Slc8b1'
ID447551
Institutional Source Beutler Lab
Gene Symbol Slc8b1
Ensembl Gene ENSMUSG00000032754
Gene Namesolute carrier family 8 (sodium/lithium/calcium exchanger), member B1
SynonymsNCLX, NCKX6, Slc24a6
Accession Numbers

Ncbi RefSeq: NM_133221.2, NM_001177594.1, NM_001177595.1; MGI:2180781

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5812 (G1)
Quality Score194
Status Not validated
Chromosome5
Chromosomal Location120511168-120534024 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 120513338 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068326] [ENSMUST00000076051] [ENSMUST00000111889] [ENSMUST00000111890] [ENSMUST00000140329] [ENSMUST00000147496]
Predicted Effect probably null
Transcript: ENSMUST00000068326
SMART Domains Protein: ENSMUSP00000064714
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 103 246 5.7e-25 PFAM
low complexity region 262 275 N/A INTRINSIC
low complexity region 337 351 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Pfam:Na_Ca_ex 421 574 1.8e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076051
SMART Domains Protein: ENSMUSP00000075428
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 113 244 9.2e-19 PFAM
low complexity region 262 275 N/A INTRINSIC
transmembrane domain 323 345 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Pfam:Na_Ca_ex 431 477 2.3e-8 PFAM
low complexity region 507 519 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111889
SMART Domains Protein: ENSMUSP00000107520
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 113 232 2.5e-16 PFAM
low complexity region 281 295 N/A INTRINSIC
transmembrane domain 304 326 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
Pfam:Na_Ca_ex 375 516 1.7e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111890
SMART Domains Protein: ENSMUSP00000107521
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 116 227 2.8e-12 PFAM
low complexity region 245 258 N/A INTRINSIC
low complexity region 320 334 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 370 392 N/A INTRINSIC
Pfam:Na_Ca_ex 414 555 3.2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140329
SMART Domains Protein: ENSMUSP00000117260
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147496
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC24A6 belongs to a family of potassium-dependent sodium/calcium exchangers that maintain cellular calcium homeostasis through the electrogenic countertransport of 4 sodium ions for 1 calcium ion and 1 potassium ion (Cai and Lytton, 2004 [PubMed 14625281]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(22) : Targeted(3) Gene trapped(19)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,176,538 S9P probably damaging Het
Acsl5 G A 19: 55,294,836 V615I probably benign Het
Ankk1 T C 9: 49,426,853 K47E probably benign Het
Ankrd11 A T 8: 122,893,805 probably null Het
Bcl9l T C 9: 44,506,644 V593A probably benign Het
Cadps T C 14: 12,376,685 I1271V probably benign Het
Ccdc125 T C 13: 100,684,304 W152R probably damaging Het
Cep192 T C 18: 67,851,737 V1606A possibly damaging Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cxxc5 T A 18: 35,859,056 V170E probably damaging Het
Defb6 C T 8: 19,228,094 R61C possibly damaging Het
Dnah10 T A 5: 124,747,746 N655K probably benign Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Gli1 C T 10: 127,337,415 G125S probably damaging Het
Gm5538 T A 3: 59,747,272 Y176N probably damaging Het
Igkv14-126 A T 6: 67,896,440 I51F possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jtb T C 3: 90,233,977 S87P probably benign Het
Kdm6b A T 11: 69,405,929 I504N probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
March4 T C 1: 72,428,917 T319A probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Nt5e T C 9: 88,369,055 V459A probably damaging Het
Ogdhl A G 14: 32,332,865 K257E probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr117 A G 17: 37,659,739 L198P probably damaging Het
Osmr A T 15: 6,837,059 V378D probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pdzd7 G T 19: 45,036,871 T395K probably damaging Het
Rasgef1c A G 11: 49,957,143 D35G probably benign Het
Rbm19 T C 5: 120,141,577 F770L probably damaging Het
Rit2 C A 18: 30,975,461 C157F probably damaging Het
Slc22a22 A G 15: 57,256,473 probably null Het
Speer2 C A 16: 69,858,895 R14S possibly damaging Het
Tas2r105 C A 6: 131,686,873 L197F possibly damaging Het
Tmprss11b T A 5: 86,665,098 H113L possibly damaging Het
Ttbk2 G A 2: 120,822,559 P64S probably damaging Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vps13c T A 9: 67,982,495 probably benign Het
Zbtb39 T A 10: 127,741,560 M1K probably null Het
Other mutations in Slc8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Slc8b1 APN 5 120532984 missense probably damaging 1.00
IGL01111:Slc8b1 APN 5 120532935 missense probably damaging 1.00
IGL02186:Slc8b1 APN 5 120527863 critical splice donor site probably null
IGL02448:Slc8b1 APN 5 120525791 missense probably damaging 1.00
IGL02501:Slc8b1 APN 5 120520853 missense probably damaging 1.00
IGL03380:Slc8b1 APN 5 120519735 missense probably damaging 1.00
R0062:Slc8b1 UTSW 5 120521863 critical splice donor site probably null
R0062:Slc8b1 UTSW 5 120521863 critical splice donor site probably null
R0082:Slc8b1 UTSW 5 120524200 unclassified probably benign
R0532:Slc8b1 UTSW 5 120519671 missense probably damaging 0.99
R0550:Slc8b1 UTSW 5 120531155 splice site probably benign
R0751:Slc8b1 UTSW 5 120524195 unclassified probably benign
R1667:Slc8b1 UTSW 5 120521082 missense probably benign 0.39
R1710:Slc8b1 UTSW 5 120519652 missense probably damaging 1.00
R1731:Slc8b1 UTSW 5 120521115 missense probably benign 0.12
R1865:Slc8b1 UTSW 5 120529652 missense probably damaging 1.00
R2829:Slc8b1 UTSW 5 120524013 missense probably benign 0.22
R4544:Slc8b1 UTSW 5 120531153 splice site probably null
R4553:Slc8b1 UTSW 5 120529598 missense probably damaging 0.98
R4976:Slc8b1 UTSW 5 120525675 nonsense probably null
R4977:Slc8b1 UTSW 5 120524287 missense possibly damaging 0.51
R5690:Slc8b1 UTSW 5 120513205 nonsense probably null
R6030:Slc8b1 UTSW 5 120519920 critical splice donor site probably null
R6030:Slc8b1 UTSW 5 120519920 critical splice donor site probably null
R6107:Slc8b1 UTSW 5 120529600 missense probably damaging 0.99
R6411:Slc8b1 UTSW 5 120521126 missense probably damaging 0.99
R6486:Slc8b1 UTSW 5 120533002 missense probably damaging 1.00
R6542:Slc8b1 UTSW 5 120529517 missense probably damaging 1.00
R6550:Slc8b1 UTSW 5 120524017 missense probably damaging 1.00
R6992:Slc8b1 UTSW 5 120527815 missense probably damaging 0.98
R7672:Slc8b1 UTSW 5 120533035 missense probably damaging 0.99
R8056:Slc8b1 UTSW 5 120520617 missense probably damaging 1.00
R8444:Slc8b1 UTSW 5 120513138 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGCCATGCATATGCTAAAATCCC -3'
(R):5'- TCAGGCCAACATCACCTTTC -3'

Sequencing Primer
(F):5'- TACCCTGCAGGCACTAGAG -3'
(R):5'- ATGTCTGTCCCGTCAAAGAG -3'
Posted On2016-12-15