Incidental Mutation 'R5812:Tas2r105'
ID447555
Institutional Source Beutler Lab
Gene Symbol Tas2r105
Ensembl Gene ENSMUSG00000051153
Gene Nametaste receptor, type 2, member 105
SynonymsT2r5, Tas2r5, T2R05, T2R9, mGR05, mt2r5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R5812 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location131686532-131687495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 131686873 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 197 (L197F)
Ref Sequence ENSEMBL: ENSMUSP00000058006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053652
AA Change: L197F

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153
AA Change: L197F

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072404
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080619
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation respond normally to a variety of bitter, sweet, umami, salty and sour stimuli but show a striking and selective impairement in their ability to taste cycloheximide (a bitter tastant). In addition, homozygotes are no longer behaviorally averse to cycloheximide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,176,538 S9P probably damaging Het
Acsl5 G A 19: 55,294,836 V615I probably benign Het
Ankk1 T C 9: 49,426,853 K47E probably benign Het
Ankrd11 A T 8: 122,893,805 probably null Het
Bcl9l T C 9: 44,506,644 V593A probably benign Het
Cadps T C 14: 12,376,685 I1271V probably benign Het
Ccdc125 T C 13: 100,684,304 W152R probably damaging Het
Cep192 T C 18: 67,851,737 V1606A possibly damaging Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cxxc5 T A 18: 35,859,056 V170E probably damaging Het
Defb6 C T 8: 19,228,094 R61C possibly damaging Het
Dnah10 T A 5: 124,747,746 N655K probably benign Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Gli1 C T 10: 127,337,415 G125S probably damaging Het
Gm5538 T A 3: 59,747,272 Y176N probably damaging Het
Igkv14-126 A T 6: 67,896,440 I51F possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jtb T C 3: 90,233,977 S87P probably benign Het
Kdm6b A T 11: 69,405,929 I504N probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
March4 T C 1: 72,428,917 T319A probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Nt5e T C 9: 88,369,055 V459A probably damaging Het
Ogdhl A G 14: 32,332,865 K257E probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr117 A G 17: 37,659,739 L198P probably damaging Het
Osmr A T 15: 6,837,059 V378D probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pdzd7 G T 19: 45,036,871 T395K probably damaging Het
Rasgef1c A G 11: 49,957,143 D35G probably benign Het
Rbm19 T C 5: 120,141,577 F770L probably damaging Het
Rit2 C A 18: 30,975,461 C157F probably damaging Het
Slc22a22 A G 15: 57,256,473 probably null Het
Slc8b1 T C 5: 120,513,338 probably null Het
Speer2 C A 16: 69,858,895 R14S possibly damaging Het
Tmprss11b T A 5: 86,665,098 H113L possibly damaging Het
Ttbk2 G A 2: 120,822,559 P64S probably damaging Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vps13c T A 9: 67,982,495 probably benign Het
Zbtb39 T A 10: 127,741,560 M1K probably null Het
Other mutations in Tas2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Tas2r105 APN 6 131687111 missense probably benign 0.02
IGL01148:Tas2r105 APN 6 131686852 missense probably damaging 1.00
IGL02882:Tas2r105 APN 6 131687180 missense possibly damaging 0.95
R0833:Tas2r105 UTSW 6 131687430 missense probably benign 0.01
R0836:Tas2r105 UTSW 6 131687430 missense probably benign 0.01
R1429:Tas2r105 UTSW 6 131686941 missense probably benign 0.01
R2010:Tas2r105 UTSW 6 131687402 missense probably benign 0.41
R2418:Tas2r105 UTSW 6 131687447 missense probably damaging 1.00
R4023:Tas2r105 UTSW 6 131686826 missense probably benign 0.02
R4026:Tas2r105 UTSW 6 131686826 missense probably benign 0.02
R4742:Tas2r105 UTSW 6 131686851 missense probably damaging 1.00
R5497:Tas2r105 UTSW 6 131686842 splice site probably null
R7191:Tas2r105 UTSW 6 131686982 missense probably damaging 0.99
R7236:Tas2r105 UTSW 6 131686760 missense probably damaging 1.00
R7482:Tas2r105 UTSW 6 131687009 missense probably benign 0.10
X0067:Tas2r105 UTSW 6 131687270 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AAAGGCTTGCTTTAGCTGGC -3'
(R):5'- TGCTAACTTCATGGGTAATCTCC -3'

Sequencing Primer
(F):5'- ATATGGATGCAGTTGTGAAACC -3'
(R):5'- ATGGGTAATCTCCTTCTCATTTGTTG -3'
Posted On2016-12-15