Incidental Mutation 'R5812:Ankk1'
ID447560
Institutional Source Beutler Lab
Gene Symbol Ankk1
Ensembl Gene ENSMUSG00000032257
Gene Nameankyrin repeat and kinase domain containing 1
Synonyms9930020N01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5812 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location49415194-49427021 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49426853 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 47 (K47E)
Ref Sequence ENSEMBL: ENSMUSP00000034792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034792]
Predicted Effect probably benign
Transcript: ENSMUST00000034792
AA Change: K47E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034792
Gene: ENSMUSG00000032257
AA Change: K47E

DomainStartEndE-ValueType
Pfam:Pkinase 35 298 4.1e-44 PFAM
Pfam:Pkinase_Tyr 36 297 7.6e-47 PFAM
ANK 369 398 1.36e-2 SMART
ANK 402 431 4.13e-2 SMART
ANK 435 464 3.51e-5 SMART
ANK 468 497 5.62e-4 SMART
ANK 501 530 5.71e-5 SMART
ANK 534 563 1.05e-3 SMART
ANK 567 596 1.12e-3 SMART
ANK 600 629 6.12e-5 SMART
ANK 633 662 1.59e-3 SMART
ANK 666 695 3.65e-3 SMART
ANK 699 728 8.39e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and protein kinase superfamily involved in signal transduction pathways. This gene is closely linked to DRD2 gene (GeneID:1813) on chr 11, and a well studied restriction fragment length polymorphism (RFLP) designated TaqIA, was originally associated with the DRD2 gene, however, later was determined to be located in exon 8 of ANKK1 gene (PMIDs: 18621654, 15146457), where it causes a nonconservative amino acid substitution. It is not clear if this gene plays any role in neuropsychiatric disorders previously associated with Taq1A RFLP. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,176,538 S9P probably damaging Het
Acsl5 G A 19: 55,294,836 V615I probably benign Het
Ankrd11 A T 8: 122,893,805 probably null Het
Bcl9l T C 9: 44,506,644 V593A probably benign Het
Cadps T C 14: 12,376,685 I1271V probably benign Het
Ccdc125 T C 13: 100,684,304 W152R probably damaging Het
Cep192 T C 18: 67,851,737 V1606A possibly damaging Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cxxc5 T A 18: 35,859,056 V170E probably damaging Het
Defb6 C T 8: 19,228,094 R61C possibly damaging Het
Dnah10 T A 5: 124,747,746 N655K probably benign Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Gli1 C T 10: 127,337,415 G125S probably damaging Het
Gm5538 T A 3: 59,747,272 Y176N probably damaging Het
Igkv14-126 A T 6: 67,896,440 I51F possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jtb T C 3: 90,233,977 S87P probably benign Het
Kdm6b A T 11: 69,405,929 I504N probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
March4 T C 1: 72,428,917 T319A probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Nt5e T C 9: 88,369,055 V459A probably damaging Het
Ogdhl A G 14: 32,332,865 K257E probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr117 A G 17: 37,659,739 L198P probably damaging Het
Osmr A T 15: 6,837,059 V378D probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pdzd7 G T 19: 45,036,871 T395K probably damaging Het
Rasgef1c A G 11: 49,957,143 D35G probably benign Het
Rbm19 T C 5: 120,141,577 F770L probably damaging Het
Rit2 C A 18: 30,975,461 C157F probably damaging Het
Slc22a22 A G 15: 57,256,473 probably null Het
Slc8b1 T C 5: 120,513,338 probably null Het
Speer2 C A 16: 69,858,895 R14S possibly damaging Het
Tas2r105 C A 6: 131,686,873 L197F possibly damaging Het
Tmprss11b T A 5: 86,665,098 H113L possibly damaging Het
Ttbk2 G A 2: 120,822,559 P64S probably damaging Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vps13c T A 9: 67,982,495 probably benign Het
Zbtb39 T A 10: 127,741,560 M1K probably null Het
Other mutations in Ankk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ankk1 APN 9 49421900 missense probably benign 0.30
IGL00495:Ankk1 APN 9 49415843 missense probably benign 0.00
IGL01316:Ankk1 APN 9 49420484 unclassified probably benign
IGL01359:Ankk1 APN 9 49416028 missense possibly damaging 0.95
IGL01464:Ankk1 APN 9 49415972 missense probably benign 0.26
IGL01719:Ankk1 APN 9 49416781 missense probably benign 0.08
IGL02057:Ankk1 APN 9 49416772 missense probably damaging 1.00
IGL02549:Ankk1 APN 9 49418693 missense probably damaging 1.00
IGL02690:Ankk1 APN 9 49421900 missense probably damaging 0.99
IGL03083:Ankk1 APN 9 49421866 missense probably benign 0.15
IGL03168:Ankk1 APN 9 49415768 missense possibly damaging 0.89
IGL03289:Ankk1 APN 9 49415695 missense probably benign 0.00
R0319:Ankk1 UTSW 9 49416071 missense probably damaging 0.97
R0539:Ankk1 UTSW 9 49418030 missense probably benign
R0827:Ankk1 UTSW 9 49421737 missense possibly damaging 0.81
R1474:Ankk1 UTSW 9 49415839 missense probably damaging 1.00
R1818:Ankk1 UTSW 9 49420425 missense probably benign 0.06
R1851:Ankk1 UTSW 9 49415850 missense probably benign
R2044:Ankk1 UTSW 9 49419364 critical splice donor site probably null
R2088:Ankk1 UTSW 9 49421965 unclassified probably benign
R2353:Ankk1 UTSW 9 49418690 missense probably benign
R2897:Ankk1 UTSW 9 49421822 missense probably benign 0.00
R2898:Ankk1 UTSW 9 49421822 missense probably benign 0.00
R3121:Ankk1 UTSW 9 49426967 missense probably benign 0.21
R3714:Ankk1 UTSW 9 49421713 missense possibly damaging 0.92
R4455:Ankk1 UTSW 9 49418066 missense probably benign 0.00
R4757:Ankk1 UTSW 9 49415930 missense probably benign
R4893:Ankk1 UTSW 9 49415683 missense probably benign 0.00
R5090:Ankk1 UTSW 9 49421763 missense probably damaging 0.98
R5521:Ankk1 UTSW 9 49420448 missense probably benign 0.05
R5853:Ankk1 UTSW 9 49418695 missense possibly damaging 0.58
R5873:Ankk1 UTSW 9 49415896 missense probably benign 0.19
R6119:Ankk1 UTSW 9 49426883 missense possibly damaging 0.88
R6328:Ankk1 UTSW 9 49416071 missense possibly damaging 0.84
R6606:Ankk1 UTSW 9 49416346 missense probably benign 0.29
R6689:Ankk1 UTSW 9 49420476 missense probably damaging 1.00
R6745:Ankk1 UTSW 9 49416180 missense probably benign 0.00
R6856:Ankk1 UTSW 9 49420020 missense probably benign 0.39
R7424:Ankk1 UTSW 9 49418750 missense possibly damaging 0.93
R8145:Ankk1 UTSW 9 49415797 missense possibly damaging 0.63
Z1176:Ankk1 UTSW 9 49416643 missense probably benign 0.01
Z1176:Ankk1 UTSW 9 49421911 missense probably damaging 1.00
Z1177:Ankk1 UTSW 9 49415944 missense probably damaging 0.99
Z1177:Ankk1 UTSW 9 49416487 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAATTCAGATCGCAGGGCTC -3'
(R):5'- TCGCTGCCAGAGTAAGGTG -3'

Sequencing Primer
(F):5'- TCGCAGGGCTCATTTAAAAGC -3'
(R):5'- CCAGAGTAAGGTGCGGTGC -3'
Posted On2016-12-15