Incidental Mutation 'R5812:Nr2e3'
ID447561
Institutional Source Beutler Lab
Gene Symbol Nr2e3
Ensembl Gene ENSMUSG00000032292
Gene Namenuclear receptor subfamily 2, group E, member 3
SynonymsRNR, photoreceptor-specific nuclear receptor, Pnr
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5812 (G1)
Quality Score217
Status Not validated
Chromosome9
Chromosomal Location59942771-59960659 bp(-) (GRCm38)
Type of Mutationsmall deletion (5 aa in frame mutation)
DNA Base Change (assembly) TCCATCGGAGTGTTCCC to TC at 59943418 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034831]
Predicted Effect probably benign
Transcript: ENSMUST00000034831
SMART Domains Protein: ENSMUSP00000034831
Gene: ENSMUSG00000032292

DomainStartEndE-ValueType
ZnF_C4 37 109 1.26e-32 SMART
HOLI 209 367 3.92e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215963
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is part of a large family of nuclear receptor transcription factors involved in signaling pathways. Nuclear receptors have been shown to regulate pathways involved in embryonic development, as well as in maintenance of proper cell function in adults. Members of this family are characterized by discrete domains that function in DNA and ligand binding. This gene encodes a retinal nuclear receptor that is a ligand-dependent transcription factor. Defects in this gene are a cause of enhanced S cone syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation exhibit rossettes and a reduced number of nuclei in the retinal outer nuclear layer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,176,538 S9P probably damaging Het
Acsl5 G A 19: 55,294,836 V615I probably benign Het
Ankk1 T C 9: 49,426,853 K47E probably benign Het
Ankrd11 A T 8: 122,893,805 probably null Het
Bcl9l T C 9: 44,506,644 V593A probably benign Het
Cadps T C 14: 12,376,685 I1271V probably benign Het
Ccdc125 T C 13: 100,684,304 W152R probably damaging Het
Cep192 T C 18: 67,851,737 V1606A possibly damaging Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cxxc5 T A 18: 35,859,056 V170E probably damaging Het
Defb6 C T 8: 19,228,094 R61C possibly damaging Het
Dnah10 T A 5: 124,747,746 N655K probably benign Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Gli1 C T 10: 127,337,415 G125S probably damaging Het
Gm5538 T A 3: 59,747,272 Y176N probably damaging Het
Igkv14-126 A T 6: 67,896,440 I51F possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jtb T C 3: 90,233,977 S87P probably benign Het
Kdm6b A T 11: 69,405,929 I504N probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
March4 T C 1: 72,428,917 T319A probably benign Het
Nt5e T C 9: 88,369,055 V459A probably damaging Het
Ogdhl A G 14: 32,332,865 K257E probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr117 A G 17: 37,659,739 L198P probably damaging Het
Osmr A T 15: 6,837,059 V378D probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pdzd7 G T 19: 45,036,871 T395K probably damaging Het
Rasgef1c A G 11: 49,957,143 D35G probably benign Het
Rbm19 T C 5: 120,141,577 F770L probably damaging Het
Rit2 C A 18: 30,975,461 C157F probably damaging Het
Slc22a22 A G 15: 57,256,473 probably null Het
Slc8b1 T C 5: 120,513,338 probably null Het
Speer2 C A 16: 69,858,895 R14S possibly damaging Het
Tas2r105 C A 6: 131,686,873 L197F possibly damaging Het
Tmprss11b T A 5: 86,665,098 H113L possibly damaging Het
Ttbk2 G A 2: 120,822,559 P64S probably damaging Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vps13c T A 9: 67,982,495 probably benign Het
Zbtb39 T A 10: 127,741,560 M1K probably null Het
Other mutations in Nr2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Nr2e3 APN 9 59949008 missense probably benign 0.14
R1448:Nr2e3 UTSW 9 59943514 missense probably damaging 1.00
R1521:Nr2e3 UTSW 9 59949205 missense probably damaging 0.99
R1657:Nr2e3 UTSW 9 59948767 missense probably benign 0.08
R1819:Nr2e3 UTSW 9 59943437 missense probably damaging 1.00
R1953:Nr2e3 UTSW 9 59949796 missense probably benign 0.23
R3919:Nr2e3 UTSW 9 59943440 missense probably damaging 1.00
R3925:Nr2e3 UTSW 9 59948433 missense probably damaging 1.00
R4654:Nr2e3 UTSW 9 59949072 intron probably benign
R5239:Nr2e3 UTSW 9 59949776 splice site probably benign
R5310:Nr2e3 UTSW 9 59949334 intron probably benign
R5586:Nr2e3 UTSW 9 59949201 missense probably damaging 0.99
R5811:Nr2e3 UTSW 9 59943418 small deletion probably benign
R5813:Nr2e3 UTSW 9 59943418 small deletion probably benign
R7267:Nr2e3 UTSW 9 59948689 missense possibly damaging 0.68
R7467:Nr2e3 UTSW 9 59949151 splice site probably null
R7642:Nr2e3 UTSW 9 59947388 missense possibly damaging 0.78
R7999:Nr2e3 UTSW 9 59948999 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCAAGCAGAGTTAGGGGTATTAAG -3'
(R):5'- TCCCTGTATTGAAATGCCCC -3'

Sequencing Primer
(F):5'- ATTAGGATGGCAATGAATATGCC -3'
(R):5'- TGGCTGGCCCTGGACAAC -3'
Posted On2016-12-15