Incidental Mutation 'R5812:Nt5e'
ID447563
Institutional Source Beutler Lab
Gene Symbol Nt5e
Ensembl Gene ENSMUSG00000032420
Gene Name5' nucleotidase, ecto
Synonymsecto-5'-nucleotidase, CD73, Nt5, 2210401F01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5812 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location88327197-88372092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88369055 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 459 (V459A)
Ref Sequence ENSEMBL: ENSMUSP00000034992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034992]
Predicted Effect probably damaging
Transcript: ENSMUST00000034992
AA Change: V459A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034992
Gene: ENSMUSG00000032420
AA Change: V459A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Metallophos 31 248 2.1e-15 PFAM
Pfam:5_nucleotid_C 340 515 4.9e-45 PFAM
transmembrane domain 553 575 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187166
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a membrane-bound nucleotidase that hydrolyzes extracellular nucleoside monophosphates. The encoded preproprotein undergoes proteolytic processing to generate to a functional, homodimeric enzyme that preferentially uses adenosine monophosphate as a substrate to generate free adenosine. Mice lacking the encoded protein exhibit a significantly reduced fall in stop flow pressure and superficial nephron glomerular filtration rate in response to a saturating increase of tubular perfusion flow. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mice for one allele are viable and fertile with increased circulating alkaline phosphatase and impaired tubuloglomerular feedback regulation. Homozygous null mice for a second allele display increased vascular permeability especially under hypoxic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,176,538 S9P probably damaging Het
Acsl5 G A 19: 55,294,836 V615I probably benign Het
Ankk1 T C 9: 49,426,853 K47E probably benign Het
Ankrd11 A T 8: 122,893,805 probably null Het
Bcl9l T C 9: 44,506,644 V593A probably benign Het
Cadps T C 14: 12,376,685 I1271V probably benign Het
Ccdc125 T C 13: 100,684,304 W152R probably damaging Het
Cep192 T C 18: 67,851,737 V1606A possibly damaging Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cxxc5 T A 18: 35,859,056 V170E probably damaging Het
Defb6 C T 8: 19,228,094 R61C possibly damaging Het
Dnah10 T A 5: 124,747,746 N655K probably benign Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Gli1 C T 10: 127,337,415 G125S probably damaging Het
Gm5538 T A 3: 59,747,272 Y176N probably damaging Het
Igkv14-126 A T 6: 67,896,440 I51F possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jtb T C 3: 90,233,977 S87P probably benign Het
Kdm6b A T 11: 69,405,929 I504N probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
March4 T C 1: 72,428,917 T319A probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Ogdhl A G 14: 32,332,865 K257E probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr117 A G 17: 37,659,739 L198P probably damaging Het
Osmr A T 15: 6,837,059 V378D probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pdzd7 G T 19: 45,036,871 T395K probably damaging Het
Rasgef1c A G 11: 49,957,143 D35G probably benign Het
Rbm19 T C 5: 120,141,577 F770L probably damaging Het
Rit2 C A 18: 30,975,461 C157F probably damaging Het
Slc22a22 A G 15: 57,256,473 probably null Het
Slc8b1 T C 5: 120,513,338 probably null Het
Speer2 C A 16: 69,858,895 R14S possibly damaging Het
Tas2r105 C A 6: 131,686,873 L197F possibly damaging Het
Tmprss11b T A 5: 86,665,098 H113L possibly damaging Het
Ttbk2 G A 2: 120,822,559 P64S probably damaging Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vps13c T A 9: 67,982,495 probably benign Het
Zbtb39 T A 10: 127,741,560 M1K probably null Het
Other mutations in Nt5e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01794:Nt5e APN 9 88367298 missense probably damaging 0.97
IGL02015:Nt5e APN 9 88367237 missense probably damaging 1.00
IGL02351:Nt5e APN 9 88327893 missense probably damaging 1.00
IGL02358:Nt5e APN 9 88327893 missense probably damaging 1.00
IGL02826:Nt5e APN 9 88355705 missense probably damaging 0.97
IGL03237:Nt5e APN 9 88355734 missense probably damaging 1.00
R0092:Nt5e UTSW 9 88370285 missense probably benign 0.00
R0238:Nt5e UTSW 9 88367332 missense possibly damaging 0.81
R0238:Nt5e UTSW 9 88367332 missense possibly damaging 0.81
R0557:Nt5e UTSW 9 88366466 missense probably damaging 1.00
R1727:Nt5e UTSW 9 88328029 missense possibly damaging 0.87
R1834:Nt5e UTSW 9 88370187 missense probably damaging 1.00
R2361:Nt5e UTSW 9 88370237 missense possibly damaging 0.67
R3871:Nt5e UTSW 9 88364693 missense probably benign 0.04
R4990:Nt5e UTSW 9 88355593 missense probably benign 0.03
R5039:Nt5e UTSW 9 88363581 missense probably benign 0.00
R5642:Nt5e UTSW 9 88327687 start codon destroyed probably null 0.02
R6389:Nt5e UTSW 9 88363471 missense probably damaging 1.00
R7003:Nt5e UTSW 9 88364752 missense probably damaging 1.00
R8325:Nt5e UTSW 9 88363562 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GGACTCAAGGATGAAGCTGC -3'
(R):5'- GAAGAGACACCTGTGCTTACCAG -3'

Sequencing Primer
(F):5'- GCGGGTAGCTACACCATCAC -3'
(R):5'- ACACCTGTGCTTACCAGAGTCATG -3'
Posted On2016-12-15