Incidental Mutation 'R5812:Gli1'
ID447564
Institutional Source Beutler Lab
Gene Symbol Gli1
Ensembl Gene ENSMUSG00000025407
Gene NameGLI-Kruppel family member GLI1
SynonymsZfp-5, Zfp5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5812 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127329882-127341974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127337415 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 125 (G125S)
Ref Sequence ENSEMBL: ENSMUSP00000026474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026474] [ENSMUST00000218236] [ENSMUST00000219671]
Predicted Effect probably damaging
Transcript: ENSMUST00000026474
AA Change: G125S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026474
Gene: ENSMUSG00000025407
AA Change: G125S

DomainStartEndE-ValueType
low complexity region 222 237 N/A INTRINSIC
ZnF_C2H2 238 263 1.33e-1 SMART
ZnF_C2H2 271 298 5.72e-1 SMART
ZnF_C2H2 304 328 2.57e-3 SMART
ZnF_C2H2 334 359 1.92e-2 SMART
ZnF_C2H2 365 390 2.61e-4 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 540 562 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 850 873 N/A INTRINSIC
low complexity region 941 962 N/A INTRINSIC
low complexity region 985 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219640
Predicted Effect probably benign
Transcript: ENSMUST00000219671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219808
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel family of zinc finger proteins. The encoded transcription factor is activated by the sonic hedgehog signal transduction cascade and regulates stem cell proliferation. The activity and nuclear localization of this protein is negatively regulated by p53 in an inhibitory loop. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a targeted null mutation are apparently normal, but homozygotes that are also heterozygous for a Gli2 knockout die soon after birth with multiple defects, while Gli2 knockout heterozygotes are normally viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,176,538 S9P probably damaging Het
Acsl5 G A 19: 55,294,836 V615I probably benign Het
Ankk1 T C 9: 49,426,853 K47E probably benign Het
Ankrd11 A T 8: 122,893,805 probably null Het
Bcl9l T C 9: 44,506,644 V593A probably benign Het
Cadps T C 14: 12,376,685 I1271V probably benign Het
Ccdc125 T C 13: 100,684,304 W152R probably damaging Het
Cep192 T C 18: 67,851,737 V1606A possibly damaging Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cxxc5 T A 18: 35,859,056 V170E probably damaging Het
Defb6 C T 8: 19,228,094 R61C possibly damaging Het
Dnah10 T A 5: 124,747,746 N655K probably benign Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Gm5538 T A 3: 59,747,272 Y176N probably damaging Het
Igkv14-126 A T 6: 67,896,440 I51F possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jtb T C 3: 90,233,977 S87P probably benign Het
Kdm6b A T 11: 69,405,929 I504N probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
March4 T C 1: 72,428,917 T319A probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Nt5e T C 9: 88,369,055 V459A probably damaging Het
Ogdhl A G 14: 32,332,865 K257E probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr117 A G 17: 37,659,739 L198P probably damaging Het
Osmr A T 15: 6,837,059 V378D probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pdzd7 G T 19: 45,036,871 T395K probably damaging Het
Rasgef1c A G 11: 49,957,143 D35G probably benign Het
Rbm19 T C 5: 120,141,577 F770L probably damaging Het
Rit2 C A 18: 30,975,461 C157F probably damaging Het
Slc22a22 A G 15: 57,256,473 probably null Het
Slc8b1 T C 5: 120,513,338 probably null Het
Speer2 C A 16: 69,858,895 R14S possibly damaging Het
Tas2r105 C A 6: 131,686,873 L197F possibly damaging Het
Tmprss11b T A 5: 86,665,098 H113L possibly damaging Het
Ttbk2 G A 2: 120,822,559 P64S probably damaging Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vps13c T A 9: 67,982,495 probably benign Het
Zbtb39 T A 10: 127,741,560 M1K probably null Het
Other mutations in Gli1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Gli1 APN 10 127332478 missense probably damaging 1.00
IGL01824:Gli1 APN 10 127336527 missense probably benign 0.44
IGL02134:Gli1 APN 10 127336500 missense probably benign 0.00
IGL02508:Gli1 APN 10 127337092 missense probably benign 0.14
IGL02931:Gli1 APN 10 127332410 missense probably benign 0.00
R0099:Gli1 UTSW 10 127336006 missense probably damaging 1.00
R0590:Gli1 UTSW 10 127331563 missense possibly damaging 0.82
R0792:Gli1 UTSW 10 127332577 missense probably damaging 0.99
R1169:Gli1 UTSW 10 127338451 missense probably damaging 1.00
R1519:Gli1 UTSW 10 127334269 missense possibly damaging 0.93
R1522:Gli1 UTSW 10 127332577 missense probably damaging 0.99
R1550:Gli1 UTSW 10 127338516 missense probably damaging 1.00
R1592:Gli1 UTSW 10 127331329 missense probably damaging 0.97
R1879:Gli1 UTSW 10 127333737 missense probably damaging 1.00
R1892:Gli1 UTSW 10 127330106 missense possibly damaging 0.82
R1934:Gli1 UTSW 10 127331239 missense possibly damaging 0.65
R2049:Gli1 UTSW 10 127336727 missense probably damaging 1.00
R2088:Gli1 UTSW 10 127331500 missense probably damaging 1.00
R2141:Gli1 UTSW 10 127336727 missense probably damaging 1.00
R3803:Gli1 UTSW 10 127338065 splice site probably benign
R3873:Gli1 UTSW 10 127331356 missense probably damaging 1.00
R3874:Gli1 UTSW 10 127330219 missense probably damaging 1.00
R3899:Gli1 UTSW 10 127336666 missense possibly damaging 0.64
R4703:Gli1 UTSW 10 127330855 missense possibly damaging 0.88
R5552:Gli1 UTSW 10 127330262 missense probably benign 0.00
R5686:Gli1 UTSW 10 127337436 missense probably benign 0.01
R6053:Gli1 UTSW 10 127334315 missense probably damaging 1.00
R7088:Gli1 UTSW 10 127335999 missense probably damaging 1.00
R7162:Gli1 UTSW 10 127332437 missense probably benign
R8229:Gli1 UTSW 10 127332448 missense possibly damaging 0.93
R8322:Gli1 UTSW 10 127331608 missense probably damaging 1.00
R8447:Gli1 UTSW 10 127330237 missense probably benign 0.00
Z1177:Gli1 UTSW 10 127334257 missense probably damaging 1.00
Z1177:Gli1 UTSW 10 127335998 missense probably damaging 1.00
Z1177:Gli1 UTSW 10 127336691 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGAAGCCCTGGGGAGGTC -3'
(R):5'- AAGTGCAGGGATACAATGTACCTT -3'

Sequencing Primer
(F):5'- TCCTGAAGAGGGTTCCAATGC -3'
(R):5'- CTCAGATTCTTTGAAGGAACGGC -3'
Posted On2016-12-15