Incidental Mutation 'R5812:Zbtb39'
ID447565
Institutional Source Beutler Lab
Gene Symbol Zbtb39
Ensembl Gene ENSMUSG00000044617
Gene Namezinc finger and BTB domain containing 39
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R5812 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127739538-127747349 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 127741560 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000052717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054287]
Predicted Effect probably null
Transcript: ENSMUST00000054287
AA Change: M1K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052717
Gene: ENSMUSG00000044617
AA Change: M1K

DomainStartEndE-ValueType
BTB 30 126 9.15e-24 SMART
low complexity region 197 206 N/A INTRINSIC
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 372 394 6.4e0 SMART
ZnF_C2H2 400 420 3.21e1 SMART
ZnF_C2H2 451 474 9.31e1 SMART
ZnF_C2H2 480 502 6.92e0 SMART
ZnF_C2H2 508 530 1.79e-2 SMART
ZnF_C2H2 538 560 1.18e-2 SMART
ZnF_C2H2 605 627 2.57e-3 SMART
ZnF_C2H2 633 655 3.78e-1 SMART
ZnF_C2H2 661 683 2.49e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,176,538 S9P probably damaging Het
Acsl5 G A 19: 55,294,836 V615I probably benign Het
Ankk1 T C 9: 49,426,853 K47E probably benign Het
Ankrd11 A T 8: 122,893,805 probably null Het
Bcl9l T C 9: 44,506,644 V593A probably benign Het
Cadps T C 14: 12,376,685 I1271V probably benign Het
Ccdc125 T C 13: 100,684,304 W152R probably damaging Het
Cep192 T C 18: 67,851,737 V1606A possibly damaging Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cxxc5 T A 18: 35,859,056 V170E probably damaging Het
Defb6 C T 8: 19,228,094 R61C possibly damaging Het
Dnah10 T A 5: 124,747,746 N655K probably benign Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Gli1 C T 10: 127,337,415 G125S probably damaging Het
Gm5538 T A 3: 59,747,272 Y176N probably damaging Het
Igkv14-126 A T 6: 67,896,440 I51F possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jtb T C 3: 90,233,977 S87P probably benign Het
Kdm6b A T 11: 69,405,929 I504N probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
March4 T C 1: 72,428,917 T319A probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Nt5e T C 9: 88,369,055 V459A probably damaging Het
Ogdhl A G 14: 32,332,865 K257E probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr117 A G 17: 37,659,739 L198P probably damaging Het
Osmr A T 15: 6,837,059 V378D probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pdzd7 G T 19: 45,036,871 T395K probably damaging Het
Rasgef1c A G 11: 49,957,143 D35G probably benign Het
Rbm19 T C 5: 120,141,577 F770L probably damaging Het
Rit2 C A 18: 30,975,461 C157F probably damaging Het
Slc22a22 A G 15: 57,256,473 probably null Het
Slc8b1 T C 5: 120,513,338 probably null Het
Speer2 C A 16: 69,858,895 R14S possibly damaging Het
Tas2r105 C A 6: 131,686,873 L197F possibly damaging Het
Tmprss11b T A 5: 86,665,098 H113L possibly damaging Het
Ttbk2 G A 2: 120,822,559 P64S probably damaging Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vps13c T A 9: 67,982,495 probably benign Het
Other mutations in Zbtb39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Zbtb39 APN 10 127742366 missense probably benign 0.00
R0636:Zbtb39 UTSW 10 127742835 missense probably benign 0.01
R0959:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R0959:Zbtb39 UTSW 10 127743062 missense probably damaging 1.00
R0962:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R0964:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R1188:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R1189:Zbtb39 UTSW 10 127742306 missense probably benign 0.31
R1239:Zbtb39 UTSW 10 127743069 missense probably damaging 1.00
R1341:Zbtb39 UTSW 10 127743500 missense possibly damaging 0.91
R1838:Zbtb39 UTSW 10 127742700 missense probably damaging 1.00
R2012:Zbtb39 UTSW 10 127742834 missense probably benign 0.43
R2167:Zbtb39 UTSW 10 127742975 missense probably benign 0.03
R2346:Zbtb39 UTSW 10 127741581 missense possibly damaging 0.49
R4041:Zbtb39 UTSW 10 127743554 missense probably damaging 1.00
R4171:Zbtb39 UTSW 10 127742367 missense possibly damaging 0.51
R4409:Zbtb39 UTSW 10 127742827 missense possibly damaging 0.51
R4410:Zbtb39 UTSW 10 127742827 missense possibly damaging 0.51
R4539:Zbtb39 UTSW 10 127742192 missense possibly damaging 0.90
R5761:Zbtb39 UTSW 10 127742646 missense probably damaging 1.00
R5766:Zbtb39 UTSW 10 127742688 missense probably damaging 1.00
R6710:Zbtb39 UTSW 10 127743636 missense probably damaging 1.00
R6919:Zbtb39 UTSW 10 127741842 missense probably damaging 1.00
R7941:Zbtb39 UTSW 10 127743540 missense probably damaging 1.00
X0024:Zbtb39 UTSW 10 127741766 missense probably damaging 1.00
Z1177:Zbtb39 UTSW 10 127742427 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGCAGGGTGAAGGTCATTCC -3'
(R):5'- TCTAGCCCAGTGTTTAAGAAGAG -3'

Sequencing Primer
(F):5'- GGTGAAGGTCATTCCCCACTC -3'
(R):5'- AGCCCAGTGTTTAAGAAGAGGTTCTG -3'
Posted On2016-12-15