Incidental Mutation 'R5812:Map2k4'
ID447567
Institutional Source Beutler Lab
Gene Symbol Map2k4
Ensembl Gene ENSMUSG00000033352
Gene Namemitogen-activated protein kinase kinase 4
SynonymsSerk1, MKK4, Sek1, JNKK1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5812 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location65688243-65788297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65735205 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 136 (I136T)
Ref Sequence ENSEMBL: ENSMUSP00000114219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046963] [ENSMUST00000130009] [ENSMUST00000138093] [ENSMUST00000140301] [ENSMUST00000152096]
Predicted Effect probably benign
Transcript: ENSMUST00000046963
AA Change: I125T

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000041282
Gene: ENSMUSG00000033352
AA Change: I125T

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
S_TKc 100 365 9.38e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103261
Predicted Effect probably benign
Transcript: ENSMUST00000130009
SMART Domains Protein: ENSMUSP00000137819
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138093
AA Change: I9T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000140301
SMART Domains Protein: ENSMUSP00000137955
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152096
AA Change: I136T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114219
Gene: ENSMUSG00000033352
AA Change: I136T

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 111 202 2.5e-9 PFAM
Pfam:Pkinase 111 204 1e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein kinase (MAPK) family. Members of this family act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation, and development. They form a three-tiered signaling module composed of MAPKKKs, MAPKKs, and MAPKs. This protein is phosphorylated at serine and threonine residues by MAPKKKs and subsequently phosphorylates downstream MAPK targets at threonine and tyrosine residues. A similar protein in mouse has been reported to play a role in liver organogenesis. A pseudogene of this gene is located on the long arm of chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormal liver development with a deficiency of parenchymal hepatocytes, severe anemia, and lethality before embryonic day 14.0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,176,538 S9P probably damaging Het
Acsl5 G A 19: 55,294,836 V615I probably benign Het
Ankk1 T C 9: 49,426,853 K47E probably benign Het
Ankrd11 A T 8: 122,893,805 probably null Het
Bcl9l T C 9: 44,506,644 V593A probably benign Het
Cadps T C 14: 12,376,685 I1271V probably benign Het
Ccdc125 T C 13: 100,684,304 W152R probably damaging Het
Cep192 T C 18: 67,851,737 V1606A possibly damaging Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cxxc5 T A 18: 35,859,056 V170E probably damaging Het
Defb6 C T 8: 19,228,094 R61C possibly damaging Het
Dnah10 T A 5: 124,747,746 N655K probably benign Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Gli1 C T 10: 127,337,415 G125S probably damaging Het
Gm5538 T A 3: 59,747,272 Y176N probably damaging Het
Igkv14-126 A T 6: 67,896,440 I51F possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jtb T C 3: 90,233,977 S87P probably benign Het
Kdm6b A T 11: 69,405,929 I504N probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
March4 T C 1: 72,428,917 T319A probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Nt5e T C 9: 88,369,055 V459A probably damaging Het
Ogdhl A G 14: 32,332,865 K257E probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr117 A G 17: 37,659,739 L198P probably damaging Het
Osmr A T 15: 6,837,059 V378D probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pdzd7 G T 19: 45,036,871 T395K probably damaging Het
Rasgef1c A G 11: 49,957,143 D35G probably benign Het
Rbm19 T C 5: 120,141,577 F770L probably damaging Het
Rit2 C A 18: 30,975,461 C157F probably damaging Het
Slc22a22 A G 15: 57,256,473 probably null Het
Slc8b1 T C 5: 120,513,338 probably null Het
Speer2 C A 16: 69,858,895 R14S possibly damaging Het
Tas2r105 C A 6: 131,686,873 L197F possibly damaging Het
Tmprss11b T A 5: 86,665,098 H113L possibly damaging Het
Ttbk2 G A 2: 120,822,559 P64S probably damaging Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vps13c T A 9: 67,982,495 probably benign Het
Zbtb39 T A 10: 127,741,560 M1K probably null Het
Other mutations in Map2k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Map2k4 APN 11 65719479 splice site probably benign
IGL01318:Map2k4 APN 11 65756263 splice site probably benign
IGL02500:Map2k4 APN 11 65696310 missense probably damaging 1.00
IGL02628:Map2k4 APN 11 65690741 missense possibly damaging 0.83
IGL02873:Map2k4 APN 11 65719574 missense probably damaging 0.97
IGL03124:Map2k4 APN 11 65690791 missense probably damaging 0.98
R0021:Map2k4 UTSW 11 65712284 missense probably damaging 1.00
R0021:Map2k4 UTSW 11 65712284 missense probably damaging 1.00
R0034:Map2k4 UTSW 11 65719611 splice site probably benign
R0034:Map2k4 UTSW 11 65719611 splice site probably benign
R0646:Map2k4 UTSW 11 65712275 missense probably damaging 1.00
R2073:Map2k4 UTSW 11 65693456 missense probably damaging 0.99
R2931:Map2k4 UTSW 11 65756337 missense probably damaging 0.99
R3800:Map2k4 UTSW 11 65690781 nonsense probably null
R4820:Map2k4 UTSW 11 65696375 splice site probably benign
R4913:Map2k4 UTSW 11 65709932 missense probably damaging 1.00
R5452:Map2k4 UTSW 11 65719587 missense probably damaging 0.97
R5497:Map2k4 UTSW 11 65735205 missense probably damaging 1.00
R5976:Map2k4 UTSW 11 65709952 missense probably benign 0.31
R6282:Map2k4 UTSW 11 65707016 missense possibly damaging 0.78
R6505:Map2k4 UTSW 11 65693529 missense possibly damaging 0.63
R6784:Map2k4 UTSW 11 65691751 unclassified probably benign
R7560:Map2k4 UTSW 11 65775757 missense unknown
R8071:Map2k4 UTSW 11 65707001 missense
Predicted Primers PCR Primer
(F):5'- GGGGCCAGAAGTTTAAAACCTG -3'
(R):5'- TGTTCCCACACGTACTCAGTG -3'

Sequencing Primer
(F):5'- GGCCAGAAGTTTAAAACCTGTTAATG -3'
(R):5'- ACGTACTCAGTGCTAGCTAAAAG -3'
Posted On2016-12-15