Incidental Mutation 'R0545:Rsph6a'
ID44757
Institutional Source Beutler Lab
Gene Symbol Rsph6a
Ensembl Gene ENSMUSG00000040866
Gene Nameradial spoke head 6 homolog A (Chlamydomonas)
SynonymsRSP4, Rshl1
MMRRC Submission 038737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0545 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19054690-19074447 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 19054946 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 68 (Q68*)
Ref Sequence ENSEMBL: ENSMUSP00000076153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000035521] [ENSMUST00000076887] [ENSMUST00000146903]
Predicted Effect probably benign
Transcript: ENSMUST00000023882
SMART Domains Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
low complexity region 106 118 N/A INTRINSIC
Pfam:DUF3453 119 352 1.1e-63 PFAM
low complexity region 473 485 N/A INTRINSIC
Pfam:Symplekin_C 887 1068 4.3e-78 PFAM
low complexity region 1123 1149 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000035521
AA Change: Q68*
SMART Domains Protein: ENSMUSP00000046526
Gene: ENSMUSG00000040866
AA Change: Q68*

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 191 685 2.3e-200 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076887
AA Change: Q68*
SMART Domains Protein: ENSMUSP00000076153
Gene: ENSMUSG00000040866
AA Change: Q68*

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 188 287 3e-18 PFAM
Pfam:Radial_spoke 285 433 4.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130328
SMART Domains Protein: ENSMUSP00000115900
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:Symplekin_C 1 92 3.9e-44 PFAM
low complexity region 125 143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144991
Predicted Effect probably benign
Transcript: ENSMUST00000146903
SMART Domains Protein: ENSMUSP00000138740
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:DUF3453 117 230 1.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148861
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a sea urchin radial spoke head protein. Radial spoke protein complexes form part of the axoneme of eukaryotic flagella and are located between the axoneme's outer ring of doublet microtubules and central pair of microtubules. In Chlamydomonas, radial spoke proteins are thought to regulate the activity of dynein and the symmetry of flagellar bending patterns. This gene maps to a region of chromosome 19 that is linked to primary ciliary dyskinesia-2 (CILD2). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,542,376 R76H probably damaging Het
4932438A13Rik G A 3: 36,987,690 probably benign Het
Adnp2 T C 18: 80,129,401 I598V probably benign Het
Ago3 T C 4: 126,417,232 N63D probably damaging Het
Alkbh7 C T 17: 56,999,012 R138* probably null Het
Atp6ap1l T C 13: 90,883,663 H300R probably benign Het
BC051076 C T 5: 87,963,490 noncoding transcript Het
Bpifb9a T A 2: 154,261,950 C104* probably null Het
Cacna2d2 T C 9: 107,525,223 L826P probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc88c T C 12: 100,947,188 D526G probably damaging Het
Cdh23 T A 10: 60,331,291 T1861S probably benign Het
Ces2f A C 8: 104,950,036 M121L possibly damaging Het
Cfap58 G A 19: 47,941,097 probably benign Het
Chpf2 T C 5: 24,590,324 S282P possibly damaging Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Cma2 A T 14: 55,973,113 M86L probably benign Het
Cog6 A T 3: 52,996,075 M134K probably damaging Het
Col1a1 A G 11: 94,951,594 D1446G unknown Het
Cpne8 T A 15: 90,497,075 D512V probably damaging Het
Ctnna2 T A 6: 77,605,182 N352I probably damaging Het
Cyp2c69 A C 19: 39,886,661 L16R probably damaging Het
Dysf T C 6: 84,099,461 S603P probably damaging Het
Epha5 A G 5: 84,067,358 probably null Het
Ercc3 T C 18: 32,245,902 S270P probably damaging Het
F10 T A 8: 13,048,249 C151S probably damaging Het
Gpr180 T G 14: 118,160,046 H317Q possibly damaging Het
Gstp2 T C 19: 4,041,633 E32G possibly damaging Het
Ikzf5 T C 7: 131,392,500 T133A possibly damaging Het
Itch G T 2: 155,182,298 G274* probably null Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Lama3 T A 18: 12,561,701 S1295T possibly damaging Het
Lipc A G 9: 70,812,705 L255P probably damaging Het
Lrrc38 A G 4: 143,350,758 D197G probably benign Het
Mfap2 A G 4: 141,014,185 probably benign Het
Mfhas1 A G 8: 35,589,048 K226E probably damaging Het
Morc1 A G 16: 48,565,657 R548G probably benign Het
Mrgprb5 T C 7: 48,168,885 N34S probably benign Het
Mroh4 T C 15: 74,625,427 T182A probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo5a T C 9: 75,167,037 F743L possibly damaging Het
Notch4 A C 17: 34,583,433 D1276A probably damaging Het
Olfr139 A G 11: 74,045,047 C76R possibly damaging Het
Olfr215 T A 6: 116,582,656 I97L probably benign Het
Olfr394 A T 11: 73,888,017 Y118* probably null Het
Olfr799 T A 10: 129,647,349 C74S probably damaging Het
Plin4 T A 17: 56,106,567 T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 T827A probably benign Het
Prlr C T 15: 10,317,566 T40I probably damaging Het
Psme3 T C 11: 101,319,904 probably benign Het
Pygb A T 2: 150,815,706 D363V probably benign Het
Serpini2 A G 3: 75,258,138 V178A probably benign Het
Sh2d2a T C 3: 87,851,888 probably benign Het
Skint7 A C 4: 111,980,198 M58L probably benign Het
Slco3a1 G T 7: 74,320,553 Y435* probably null Het
Stk17b T C 1: 53,762,583 probably benign Het
Tinag T A 9: 77,031,710 H162L possibly damaging Het
Ttc21a T A 9: 119,958,799 L811Q probably damaging Het
Ttc41 A T 10: 86,759,097 M912L probably benign Het
Vmn2r98 G T 17: 19,053,613 V41F probably benign Het
Washc5 C T 15: 59,342,093 C838Y possibly damaging Het
Wrnip1 A G 13: 32,806,813 T352A probably damaging Het
Zan A C 5: 137,396,177 C4467G unknown Het
Zc3h7a T C 16: 11,152,333 probably benign Het
Zfp729a C A 13: 67,620,226 C628F probably benign Het
Other mutations in Rsph6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Rsph6a APN 7 19054868 nonsense probably null
IGL01656:Rsph6a APN 7 19054845 missense probably benign 0.00
IGL02997:Rsph6a APN 7 19054839 missense probably benign 0.32
R0396:Rsph6a UTSW 7 19074106 missense probably damaging 1.00
R0467:Rsph6a UTSW 7 19057669 missense possibly damaging 0.95
R0603:Rsph6a UTSW 7 19065961 missense possibly damaging 0.66
R0848:Rsph6a UTSW 7 19057670 missense probably benign 0.07
R1943:Rsph6a UTSW 7 19074076 missense probably damaging 1.00
R2133:Rsph6a UTSW 7 19068106 missense probably damaging 1.00
R3713:Rsph6a UTSW 7 19057550 missense probably damaging 0.98
R3762:Rsph6a UTSW 7 19055331 missense probably damaging 1.00
R3826:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R3827:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R3828:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R4355:Rsph6a UTSW 7 19067078 splice site probably null
R4429:Rsph6a UTSW 7 19074063 missense probably damaging 1.00
R4524:Rsph6a UTSW 7 19066045 missense probably damaging 1.00
R4799:Rsph6a UTSW 7 19065858 nonsense probably null
R4896:Rsph6a UTSW 7 19057740 missense possibly damaging 0.67
R4906:Rsph6a UTSW 7 19068072 missense possibly damaging 0.92
R5004:Rsph6a UTSW 7 19057740 missense possibly damaging 0.67
R5637:Rsph6a UTSW 7 19054895 missense probably benign
R6066:Rsph6a UTSW 7 19065815 missense probably damaging 1.00
R7013:Rsph6a UTSW 7 19054895 missense probably benign
R7193:Rsph6a UTSW 7 19065647 missense probably damaging 1.00
R7689:Rsph6a UTSW 7 19068037 missense possibly damaging 0.64
R8170:Rsph6a UTSW 7 19057580 missense probably damaging 1.00
R8177:Rsph6a UTSW 7 19074239 missense unknown
Z1177:Rsph6a UTSW 7 19065931 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATGCTGTGGAAGAAGCCTTGAAG -3'
(R):5'- TTGTTCTAAGAGGTCCTGGCCCTG -3'

Sequencing Primer
(F):5'- GATAGGGCAGCACACTTTTTC -3'
(R):5'- GTGGGAACTGCTCCATCATC -3'
Posted On2013-06-11