Mutagenetix > Incidental Mutations

Incidental Mutation 'R5812:Speer2'

447576

Institutional Source

Beutler Lab

Gene Symbol

Speer2

Ensembl Gene

ENSMUSG00000063163

Gene Name

spermatogenesis associated glutamate (E)-rich protein 2

Synonyms

SPEER-2

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R5812 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69856874-69863744 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 69858895 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 14 (R14S)

Ref Sequence

ENSEMBL: ENSMUSP00000130270 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076500] [ENSMUST00000164146] [ENSMUST00000166256]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076500
AA Change: R103S

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000075821
Gene: ENSMUSG00000063163
AA Change: R103S

Domain	Start	End	E-Value	Type
Pfam:Takusan	51	137	6.3e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164146

SMART Domains

Protein: ENSMUSP00000126059
Gene: ENSMUSG00000063163

Domain	Start	End	E-Value	Type
Pfam:Takusan	33	121	1.9e-33	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166256
AA Change: R14S

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000130270
Gene: ENSMUSG00000063163
AA Change: R14S

Domain	Start	End	E-Value	Type
Pfam:Takusan	1	49	2.3e-14	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	A	G	3: 138,176,538	S9P	probably damaging	Het
Acsl5	G	A	19: 55,294,836	V615I	probably benign	Het
Ankk1	T	C	9: 49,426,853	K47E	probably benign	Het
Ankrd11	A	T	8: 122,893,805		probably null	Het
Bcl9l	T	C	9: 44,506,644	V593A	probably benign	Het
Cadps	T	C	14: 12,376,685	I1271V	probably benign	Het
Ccdc125	T	C	13: 100,684,304	W152R	probably damaging	Het
Cep192	T	C	18: 67,851,737	V1606A	possibly damaging	Het
Csgalnact1	T	C	8: 68,401,384	N255S	probably benign	Het
Cxxc5	T	A	18: 35,859,056	V170E	probably damaging	Het
Defb6	C	T	8: 19,228,094	R61C	possibly damaging	Het
Dnah10	T	A	5: 124,747,746	N655K	probably benign	Het
Fry	G	A	5: 150,399,671	A1096T	probably damaging	Het
Gli1	C	T	10: 127,337,415	G125S	probably damaging	Het
Gm5538	T	A	3: 59,747,272	Y176N	probably damaging	Het
Igkv14-126	A	T	6: 67,896,440	I51F	possibly damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Jtb	T	C	3: 90,233,977	S87P	probably benign	Het
Kdm6b	A	T	11: 69,405,929	I504N	probably damaging	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Map2k4	A	G	11: 65,735,205	I136T	probably damaging	Het
March4	T	C	1: 72,428,917	T319A	probably benign	Het
Nr2e3	TCCATCGGAGTGTTCCC	TC	9: 59,943,418		probably benign	Het
Nt5e	T	C	9: 88,369,055	V459A	probably damaging	Het
Ogdhl	A	G	14: 32,332,865	K257E	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr117	A	G	17: 37,659,739	L198P	probably damaging	Het
Osmr	A	T	15: 6,837,059	V378D	probably damaging	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Pdzd7	G	T	19: 45,036,871	T395K	probably damaging	Het
Rasgef1c	A	G	11: 49,957,143	D35G	probably benign	Het
Rbm19	T	C	5: 120,141,577	F770L	probably damaging	Het
Rit2	C	A	18: 30,975,461	C157F	probably damaging	Het
Slc22a22	A	G	15: 57,256,473		probably null	Het
Slc8b1	T	C	5: 120,513,338		probably null	Het
Tas2r105	C	A	6: 131,686,873	L197F	possibly damaging	Het
Tmprss11b	T	A	5: 86,665,098	H113L	possibly damaging	Het
Ttbk2	G	A	2: 120,822,559	P64S	probably damaging	Het
Urb1	A	T	16: 90,804,537	H115Q	probably damaging	Het
Vps13c	T	A	9: 67,982,495		probably benign	Het
Zbtb39	T	A	10: 127,741,560	M1K	probably null	Het

Other mutations in Speer2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Speer2	APN	16	69860518	missense	probably benign	0.01
IGL01115:Speer2	APN	16	69861651	nonsense	probably null
IGL01694:Speer2	APN	16	69858112	missense	probably damaging	0.98
IGL01694:Speer2	APN	16	69858113	missense	probably damaging	1.00
IGL02738:Speer2	APN	16	69861712	missense	probably benign
IGL03024:Speer2	APN	16	69858115	missense	possibly damaging	0.95
IGL03062:Speer2	APN	16	69857977	missense	probably damaging	0.96
R0054:Speer2	UTSW	16	69858752	missense	probably damaging	0.99
R1248:Speer2	UTSW	16	69857067	unclassified	probably null
R1952:Speer2	UTSW	16	69857164	missense	probably damaging	0.96
R1993:Speer2	UTSW	16	69858077	missense	probably benign	0.01
R1995:Speer2	UTSW	16	69858077	missense	probably benign	0.01
R2063:Speer2	UTSW	16	69860497	missense	probably benign	0.02
R2155:Speer2	UTSW	16	69860597	missense	possibly damaging	0.63
R2216:Speer2	UTSW	16	69858842	missense	possibly damaging	0.94
R4547:Speer2	UTSW	16	69858849	missense	probably damaging	0.98
R4548:Speer2	UTSW	16	69858849	missense	probably damaging	0.98
R4625:Speer2	UTSW	16	69858754	nonsense	probably null
R4692:Speer2	UTSW	16	69857972	missense	possibly damaging	0.91
R4841:Speer2	UTSW	16	69858100	missense	probably benign	0.26
R4842:Speer2	UTSW	16	69858100	missense	probably benign	0.26
R5035:Speer2	UTSW	16	69857941	critical splice donor site	probably null
R5133:Speer2	UTSW	16	69858820	missense	probably null	0.06
R6348:Speer2	UTSW	16	69858007	missense	possibly damaging	0.83
R6854:Speer2	UTSW	16	69858887	missense	probably damaging	0.96
R7446:Speer2	UTSW	16	69858077	missense	possibly damaging	0.82
R8068:Speer2	UTSW	16	69860524	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- GAAATTGCCATTCCACTGTTGATTG -3'
(R):5'- ACCCTACTGCGTGAACACAG -3'

Sequencing Primer
(F):5'- ATTGGCTTGCTAACTGGTACTTAC -3'
(R):5'- GGAACCCTCCATCTTGATGCTTAG -3'

Posted On

2016-12-15