Incidental Mutation 'R5812:Pdzd7'
ID447584
Institutional Source Beutler Lab
Gene Symbol Pdzd7
Ensembl Gene ENSMUSG00000074818
Gene NamePDZ domain containing 7
SynonymsPdzk7, EG435601
Accession Numbers

Genbank: NM_001195265

Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R5812 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location45026906-45046614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45036871 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 395 (T395K)
Ref Sequence ENSEMBL: ENSMUSP00000133273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145391] [ENSMUST00000169459]
Predicted Effect probably damaging
Transcript: ENSMUST00000145391
AA Change: T395K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119002
Gene: ENSMUSG00000074818
AA Change: T395K

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169459
AA Change: T395K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133273
Gene: ENSMUSG00000074818
AA Change: T395K

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary protein homologous to proteins which are mutated in Usher syndrome patients, and mutations and translocations involving this gene have been associated with two types of Usher syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit profound deafness due to abnormal outer cochlear hair cell morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,176,538 S9P probably damaging Het
Acsl5 G A 19: 55,294,836 V615I probably benign Het
Ankk1 T C 9: 49,426,853 K47E probably benign Het
Ankrd11 A T 8: 122,893,805 probably null Het
Bcl9l T C 9: 44,506,644 V593A probably benign Het
Cadps T C 14: 12,376,685 I1271V probably benign Het
Ccdc125 T C 13: 100,684,304 W152R probably damaging Het
Cep192 T C 18: 67,851,737 V1606A possibly damaging Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cxxc5 T A 18: 35,859,056 V170E probably damaging Het
Defb6 C T 8: 19,228,094 R61C possibly damaging Het
Dnah10 T A 5: 124,747,746 N655K probably benign Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Gli1 C T 10: 127,337,415 G125S probably damaging Het
Gm5538 T A 3: 59,747,272 Y176N probably damaging Het
Igkv14-126 A T 6: 67,896,440 I51F possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jtb T C 3: 90,233,977 S87P probably benign Het
Kdm6b A T 11: 69,405,929 I504N probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
March4 T C 1: 72,428,917 T319A probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Nt5e T C 9: 88,369,055 V459A probably damaging Het
Ogdhl A G 14: 32,332,865 K257E probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr117 A G 17: 37,659,739 L198P probably damaging Het
Osmr A T 15: 6,837,059 V378D probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Rasgef1c A G 11: 49,957,143 D35G probably benign Het
Rbm19 T C 5: 120,141,577 F770L probably damaging Het
Rit2 C A 18: 30,975,461 C157F probably damaging Het
Slc22a22 A G 15: 57,256,473 probably null Het
Slc8b1 T C 5: 120,513,338 probably null Het
Speer2 C A 16: 69,858,895 R14S possibly damaging Het
Tas2r105 C A 6: 131,686,873 L197F possibly damaging Het
Tmprss11b T A 5: 86,665,098 H113L possibly damaging Het
Ttbk2 G A 2: 120,822,559 P64S probably damaging Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vps13c T A 9: 67,982,495 probably benign Het
Zbtb39 T A 10: 127,741,560 M1K probably null Het
Other mutations in Pdzd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Pdzd7 APN 19 45040258 missense probably damaging 1.00
IGL02729:Pdzd7 APN 19 45045643 start codon destroyed probably null 0.89
F6893:Pdzd7 UTSW 19 45036734 missense probably damaging 0.98
R0211:Pdzd7 UTSW 19 45033667 missense possibly damaging 0.72
R0211:Pdzd7 UTSW 19 45033667 missense possibly damaging 0.72
R0295:Pdzd7 UTSW 19 45037072 missense probably benign 0.01
R0523:Pdzd7 UTSW 19 45036090 missense probably benign 0.01
R0645:Pdzd7 UTSW 19 45045475 missense possibly damaging 0.95
R0731:Pdzd7 UTSW 19 45029305 missense probably damaging 1.00
R1265:Pdzd7 UTSW 19 45040685 missense possibly damaging 0.64
R1711:Pdzd7 UTSW 19 45045511 missense possibly damaging 0.68
R1789:Pdzd7 UTSW 19 45039228 missense probably damaging 1.00
R1817:Pdzd7 UTSW 19 45036176 missense probably damaging 0.98
R2162:Pdzd7 UTSW 19 45036055 critical splice donor site probably null
R2851:Pdzd7 UTSW 19 45027674 missense probably benign
R2852:Pdzd7 UTSW 19 45027674 missense probably benign
R2939:Pdzd7 UTSW 19 45045423 missense possibly damaging 0.89
R3832:Pdzd7 UTSW 19 45040254 missense probably damaging 1.00
R3874:Pdzd7 UTSW 19 45045628 missense probably benign
R4416:Pdzd7 UTSW 19 45040580 missense probably damaging 1.00
R4668:Pdzd7 UTSW 19 45045687 start gained probably benign
R5133:Pdzd7 UTSW 19 45028429 missense possibly damaging 0.51
R5327:Pdzd7 UTSW 19 45028777 missense probably benign
R5458:Pdzd7 UTSW 19 45027791 missense probably benign
R5480:Pdzd7 UTSW 19 45039285 missense possibly damaging 0.65
R5644:Pdzd7 UTSW 19 45040180 missense probably benign 0.16
R5799:Pdzd7 UTSW 19 45036989 missense probably benign 0.06
R5873:Pdzd7 UTSW 19 45027949 missense probably damaging 1.00
R6669:Pdzd7 UTSW 19 45036751 missense possibly damaging 0.94
R6750:Pdzd7 UTSW 19 45027748 missense probably benign
R7128:Pdzd7 UTSW 19 45027949 missense probably damaging 0.99
R7183:Pdzd7 UTSW 19 45037114 missense probably benign
R7378:Pdzd7 UTSW 19 45045606 missense probably damaging 0.99
R7395:Pdzd7 UTSW 19 45037011 missense probably damaging 1.00
R7426:Pdzd7 UTSW 19 45033647 missense possibly damaging 0.68
R7790:Pdzd7 UTSW 19 45045523 nonsense probably null
R7792:Pdzd7 UTSW 19 45040218 missense possibly damaging 0.54
R7829:Pdzd7 UTSW 19 45039239 missense probably benign 0.00
R7883:Pdzd7 UTSW 19 45030240 missense probably damaging 1.00
R7969:Pdzd7 UTSW 19 45036225 missense probably benign 0.01
R8387:Pdzd7 UTSW 19 45030051 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTTTGTTTGGACTAGACCCTG -3'
(R):5'- AGTGAGCAATGGGGTACTGC -3'

Sequencing Primer
(F):5'- TGTGGGAAGAGTGGCCC -3'
(R):5'- CAATGGGGTACTGCAGCAGC -3'
Posted On2016-12-15