Incidental Mutation 'R5813:Prex1'
ID447598
Institutional Source Beutler Lab
Gene Symbol Prex1
Ensembl Gene ENSMUSG00000039621
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
SynonymsP-REX1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R5813 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location166566342-166713832 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 166583207 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 960 (T960A)
Ref Sequence ENSEMBL: ENSMUSP00000096679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080] [ENSMUST00000109246]
Predicted Effect probably benign
Transcript: ENSMUST00000036719
AA Change: T1130A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: T1130A

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
RhoGEF 48 234 3.16e-52 SMART
PH 267 389 1.02e-10 SMART
DEP 418 491 6.86e-27 SMART
DEP 519 592 3.06e-24 SMART
PDZ 628 701 4.55e-1 SMART
PDZ 712 783 5.66e-1 SMART
low complexity region 800 811 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1109 1127 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099080
AA Change: T960A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621
AA Change: T960A

DomainStartEndE-ValueType
Pfam:RhoGEF 5 64 3.8e-18 PFAM
PH 97 219 1.02e-10 SMART
DEP 248 321 6.86e-27 SMART
DEP 349 422 3.06e-24 SMART
PDZ 458 531 4.55e-1 SMART
PDZ 542 613 5.66e-1 SMART
low complexity region 630 641 N/A INTRINSIC
low complexity region 644 655 N/A INTRINSIC
low complexity region 939 957 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109246
SMART Domains Protein: ENSMUSP00000104869
Gene: ENSMUSG00000039621

DomainStartEndE-ValueType
low complexity region 357 367 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 A G 3: 89,345,828 Y230H probably benign Het
Ano7 G T 1: 93,384,919 probably null Het
Arap2 T C 5: 62,677,163 Y792C probably damaging Het
Art3 C A 5: 92,412,241 probably benign Het
Atad2 C T 15: 58,099,854 G1085D probably benign Het
Birc6 C A 17: 74,646,502 A3253E probably damaging Het
C530008M17Rik A G 5: 76,858,428 T879A unknown Het
C9 C T 15: 6,497,126 P547L probably benign Het
Cecr2 T C 6: 120,762,208 S1271P probably damaging Het
Ces1e T A 8: 93,221,677 K105* probably null Het
Cpsf4 A G 5: 145,178,873 N204S probably benign Het
Dgkz T C 2: 91,939,388 D615G possibly damaging Het
Disp1 G T 1: 183,088,410 N815K probably damaging Het
Enah A G 1: 181,931,185 probably benign Het
Fcgbp A G 7: 28,101,494 T1322A possibly damaging Het
Frem1 A G 4: 83,000,158 F516L probably damaging Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Fyco1 T C 9: 123,831,348 Y190C probably damaging Het
Gfra1 T C 19: 58,239,255 D417G probably benign Het
Gigyf2 T C 1: 87,440,763 I1055T probably damaging Het
Invs A G 4: 48,398,146 E444G probably damaging Het
Itga10 A G 3: 96,652,585 T519A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kdm2b A G 5: 122,871,868 S727P probably benign Het
Kidins220 A T 12: 25,057,140 K1531* probably null Het
Ksr1 C T 11: 79,038,198 V266M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipi T C 16: 75,573,910 R140G possibly damaging Het
Lrrc32 T C 7: 98,498,411 S133P probably damaging Het
Map3k7 T A 4: 31,964,318 I19N probably damaging Het
Marf1 A G 16: 14,152,585 V90A probably benign Het
Mark3 T C 12: 111,655,443 L673P probably damaging Het
Meis1 T C 11: 19,016,229 H48R probably benign Het
Mettl26 G A 17: 25,876,021 V87M probably damaging Het
Mknk2 T C 10: 80,675,862 R5G probably benign Het
Mterf1b T C 5: 4,196,956 V199A possibly damaging Het
Ncs1 T A 2: 31,280,654 probably null Het
Nek10 T C 14: 14,986,704 V1014A probably benign Het
Notch2 A G 3: 98,135,428 N1370D probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1032 T C 2: 86,008,292 I172T probably damaging Het
Olfr922 T A 9: 38,815,656 M51K probably benign Het
Olfr952 A G 9: 39,426,736 C112R probably damaging Het
Opn5 C G 17: 42,593,006 R146T probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcyox1l C T 18: 61,699,288 probably null Het
Plxnb2 T C 15: 89,160,759 T1128A possibly damaging Het
Prkaa2 A C 4: 105,036,094 *553G probably null Het
Rasgrp4 A G 7: 29,145,214 D297G probably damaging Het
Sdf4 G A 4: 155,999,399 V109I probably benign Het
Serpinb3d T C 1: 107,079,297 K227R probably benign Het
Sgsm1 A T 5: 113,250,956 I750N probably damaging Het
Shtn1 T A 19: 59,032,241 K183M probably damaging Het
Slc22a30 T C 19: 8,404,581 T109A probably benign Het
Slco1c1 A G 6: 141,542,203 D99G probably damaging Het
Soga3 G T 10: 29,150,244 V441F probably damaging Het
Tcf25 T A 8: 123,395,615 probably null Het
Tex10 A G 4: 48,452,928 V677A probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Trappc10 T A 10: 78,222,739 N136I probably damaging Het
Trpt1 T C 19: 6,998,538 F173L probably benign Het
Ttc37 A G 13: 76,155,733 T1257A probably benign Het
Ube4b G A 4: 149,337,468 R955C probably damaging Het
Usp34 C A 11: 23,421,340 P1840T probably benign Het
Vmn1r27 A T 6: 58,216,000 N6K possibly damaging Het
Wdr25 T C 12: 109,027,421 V521A possibly damaging Het
Wdr64 G A 1: 175,812,057 E1031K possibly damaging Het
Wnt10a A G 1: 74,800,596 N147S probably damaging Het
Zbed5 T C 5: 129,902,218 I336T possibly damaging Het
Zfp758 T A 17: 22,375,815 H427Q probably damaging Het
Zfp961 C A 8: 71,968,226 H194Q probably damaging Het
Other mutations in Prex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Prex1 APN 2 166638401 missense probably damaging 1.00
IGL00309:Prex1 APN 2 166609823 missense probably damaging 0.99
IGL00953:Prex1 APN 2 166638409 missense probably damaging 1.00
IGL00961:Prex1 APN 2 166585736 missense probably damaging 0.98
IGL01300:Prex1 APN 2 166638407 missense possibly damaging 0.46
IGL01318:Prex1 APN 2 166569340 splice site probably benign
IGL01753:Prex1 APN 2 166602882 missense probably benign 0.11
IGL01819:Prex1 APN 2 166621245 missense probably damaging 1.00
IGL02058:Prex1 APN 2 166585183 missense probably benign 0.00
IGL02251:Prex1 APN 2 166577886 missense probably damaging 0.99
IGL02326:Prex1 APN 2 166621185 missense probably benign 0.35
IGL02366:Prex1 APN 2 166580427 missense probably damaging 1.00
IGL02414:Prex1 APN 2 166609828 missense probably damaging 1.00
IGL02660:Prex1 APN 2 166593867 missense probably damaging 0.97
IGL02666:Prex1 APN 2 166572989 missense probably benign 0.00
IGL02874:Prex1 APN 2 166585047 missense probably damaging 1.00
IGL02935:Prex1 APN 2 166570345 missense probably damaging 1.00
IGL03179:Prex1 APN 2 166585194 missense probably benign 0.31
R0207:Prex1 UTSW 2 166585898 missense possibly damaging 0.92
R0415:Prex1 UTSW 2 166586699 unclassified probably benign
R0420:Prex1 UTSW 2 166589571 missense probably benign 0.13
R0449:Prex1 UTSW 2 166569377 missense probably benign 0.16
R0458:Prex1 UTSW 2 166585823 missense probably damaging 0.99
R0927:Prex1 UTSW 2 166586537 missense probably benign 0.01
R1299:Prex1 UTSW 2 166585907 missense possibly damaging 0.62
R1414:Prex1 UTSW 2 166593861 missense probably damaging 1.00
R1440:Prex1 UTSW 2 166580463 missense probably damaging 0.98
R1506:Prex1 UTSW 2 166587081 missense probably damaging 1.00
R1725:Prex1 UTSW 2 166601736 missense probably damaging 1.00
R1831:Prex1 UTSW 2 166585101 missense probably damaging 1.00
R1883:Prex1 UTSW 2 166583272 missense probably benign 0.20
R1896:Prex1 UTSW 2 166586654 missense probably benign 0.01
R2022:Prex1 UTSW 2 166575614 missense possibly damaging 0.80
R2091:Prex1 UTSW 2 166569365 missense possibly damaging 0.95
R2258:Prex1 UTSW 2 166587157 missense probably benign 0.00
R2263:Prex1 UTSW 2 166589068 splice site probably benign
R2276:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2279:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2680:Prex1 UTSW 2 166601772 missense possibly damaging 0.92
R3024:Prex1 UTSW 2 166589036 missense probably benign 0.04
R3421:Prex1 UTSW 2 166617854 missense probably damaging 1.00
R3614:Prex1 UTSW 2 166609781 missense probably damaging 1.00
R4244:Prex1 UTSW 2 166570336 missense probably damaging 1.00
R4605:Prex1 UTSW 2 166713544 missense probably benign 0.45
R4685:Prex1 UTSW 2 166638332 missense probably damaging 0.97
R4787:Prex1 UTSW 2 166638340 missense probably benign 0.01
R4796:Prex1 UTSW 2 166592291 missense probably damaging 1.00
R4825:Prex1 UTSW 2 166585857 nonsense probably null
R4955:Prex1 UTSW 2 166573223 missense probably damaging 0.99
R5046:Prex1 UTSW 2 166572963 missense probably benign 0.00
R5095:Prex1 UTSW 2 166581921 missense probably damaging 1.00
R5408:Prex1 UTSW 2 166575653 small insertion probably benign
R5462:Prex1 UTSW 2 166644808 missense probably benign 0.02
R5535:Prex1 UTSW 2 166580273 missense possibly damaging 0.80
R5777:Prex1 UTSW 2 166586659 missense probably damaging 1.00
R5860:Prex1 UTSW 2 166644684 intron probably benign
R5984:Prex1 UTSW 2 166585744 missense probably damaging 1.00
R6009:Prex1 UTSW 2 166581984 missense probably damaging 1.00
R6174:Prex1 UTSW 2 166572963 missense probably benign 0.00
R6345:Prex1 UTSW 2 166572960 missense probably null 0.81
R6897:Prex1 UTSW 2 166581993 missense probably damaging 0.99
R6935:Prex1 UTSW 2 166599655 missense probably damaging 1.00
R7025:Prex1 UTSW 2 166613187 small insertion probably benign
R7037:Prex1 UTSW 2 166587180 missense probably benign 0.05
R7076:Prex1 UTSW 2 166633382 missense probably damaging 0.99
R7181:Prex1 UTSW 2 166570371 missense probably damaging 1.00
R7361:Prex1 UTSW 2 166713570 missense probably benign 0.04
R7381:Prex1 UTSW 2 166587127 missense probably damaging 1.00
R7721:Prex1 UTSW 2 166577890 nonsense probably null
R7763:Prex1 UTSW 2 166713709 missense unknown
R7809:Prex1 UTSW 2 166573244 missense possibly damaging 0.91
R7998:Prex1 UTSW 2 166587045 critical splice donor site probably null
R8029:Prex1 UTSW 2 166575603 missense probably benign 0.01
X0065:Prex1 UTSW 2 166586625 missense probably benign
Z1176:Prex1 UTSW 2 166572970 nonsense probably null
Z1177:Prex1 UTSW 2 166592228 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGGAAATGCCACAGTCTTG -3'
(R):5'- TCTCACTGTGGAGTCAGAGATG -3'

Sequencing Primer
(F):5'- GGGAAATGCCACAGTCTTGACTTTC -3'
(R):5'- TGAAGCCTGCTCTTTGATGAG -3'
Posted On2016-12-15