Incidental Mutation 'R0545:Ikzf5'
ID 44760
Institutional Source Beutler Lab
Gene Symbol Ikzf5
Ensembl Gene ENSMUSG00000040167
Gene Name IKAROS family zinc finger 5
Synonyms Zfpn1a5, 2610034F18Rik
MMRRC Submission 038737-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0545 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 131388652-131410521 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 131392500 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 133 (T133A)
Ref Sequence ENSEMBL: ENSMUSP00000035583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046306] [ENSMUST00000075610] [ENSMUST00000121033] [ENSMUST00000124096] [ENSMUST00000128432] [ENSMUST00000142349] [ENSMUST00000145114] [ENSMUST00000154602] [ENSMUST00000207243]
AlphaFold Q8BU00
Predicted Effect possibly damaging
Transcript: ENSMUST00000046306
AA Change: T133A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035583
Gene: ENSMUSG00000040167
AA Change: T133A

DomainStartEndE-ValueType
ZnF_C2H2 82 104 3.58e-2 SMART
ZnF_C2H2 110 132 1.53e-1 SMART
ZnF_C2H2 138 161 1.79e-2 SMART
low complexity region 289 320 N/A INTRINSIC
ZnF_C2H2 364 386 8.09e0 SMART
ZnF_C2H2 392 416 9.22e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075610
SMART Domains Protein: ENSMUSP00000075037
Gene: ENSMUSG00000063179

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:AAA_33 20 213 2.7e-11 PFAM
Pfam:KTI12 136 345 3.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121033
SMART Domains Protein: ENSMUSP00000113714
Gene: ENSMUSG00000040167

DomainStartEndE-ValueType
ZnF_C2H2 82 104 3.58e-2 SMART
low complexity region 136 167 N/A INTRINSIC
ZnF_C2H2 211 233 8.09e0 SMART
ZnF_C2H2 239 263 9.22e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124672
Predicted Effect probably benign
Transcript: ENSMUST00000128092
Predicted Effect probably benign
Transcript: ENSMUST00000128432
SMART Domains Protein: ENSMUSP00000139528
Gene: ENSMUSG00000040167

DomainStartEndE-ValueType
ZnF_C2H2 82 104 1.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133284
Predicted Effect probably benign
Transcript: ENSMUST00000142349
Predicted Effect probably benign
Transcript: ENSMUST00000145114
SMART Domains Protein: ENSMUSP00000118636
Gene: ENSMUSG00000063179

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:KTI12 18 88 5.6e-8 PFAM
Pfam:AAA_17 20 212 3.2e-8 PFAM
Pfam:AAA_33 20 213 2.2e-13 PFAM
Pfam:KTI12 136 265 1.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148533
Predicted Effect probably benign
Transcript: ENSMUST00000154602
SMART Domains Protein: ENSMUSP00000123530
Gene: ENSMUSG00000040167

DomainStartEndE-ValueType
ZnF_C2H2 82 104 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207243
Predicted Effect unknown
Transcript: ENSMUST00000207489
AA Change: V104A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208084
Meta Mutation Damage Score 0.1630 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the Ikaros (ZNFN1A1; MIM 603023) family of transcription factors, which includes Pegasus, are expressed in lymphocytes and are implicated in the control of lymphoid development.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,542,376 R76H probably damaging Het
4932438A13Rik G A 3: 36,987,690 probably benign Het
Adnp2 T C 18: 80,129,401 I598V probably benign Het
Ago3 T C 4: 126,417,232 N63D probably damaging Het
Alkbh7 C T 17: 56,999,012 R138* probably null Het
Atp6ap1l T C 13: 90,883,663 H300R probably benign Het
BC051076 C T 5: 87,963,490 noncoding transcript Het
Bpifb9a T A 2: 154,261,950 C104* probably null Het
Cacna2d2 T C 9: 107,525,223 L826P probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc88c T C 12: 100,947,188 D526G probably damaging Het
Cdh23 T A 10: 60,331,291 T1861S probably benign Het
Ces2f A C 8: 104,950,036 M121L possibly damaging Het
Cfap58 G A 19: 47,941,097 probably benign Het
Chpf2 T C 5: 24,590,324 S282P possibly damaging Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Cma2 A T 14: 55,973,113 M86L probably benign Het
Cog6 A T 3: 52,996,075 M134K probably damaging Het
Col1a1 A G 11: 94,951,594 D1446G unknown Het
Cpne8 T A 15: 90,497,075 D512V probably damaging Het
Ctnna2 T A 6: 77,605,182 N352I probably damaging Het
Cyp2c69 A C 19: 39,886,661 L16R probably damaging Het
Dysf T C 6: 84,099,461 S603P probably damaging Het
Epha5 A G 5: 84,067,358 probably null Het
Ercc3 T C 18: 32,245,902 S270P probably damaging Het
F10 T A 8: 13,048,249 C151S probably damaging Het
Gpr180 T G 14: 118,160,046 H317Q possibly damaging Het
Gstp2 T C 19: 4,041,633 E32G possibly damaging Het
Itch G T 2: 155,182,298 G274* probably null Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Lama3 T A 18: 12,561,701 S1295T possibly damaging Het
Lipc A G 9: 70,812,705 L255P probably damaging Het
Lrrc38 A G 4: 143,350,758 D197G probably benign Het
Mfap2 A G 4: 141,014,185 probably benign Het
Mfhas1 A G 8: 35,589,048 K226E probably damaging Het
Morc1 A G 16: 48,565,657 R548G probably benign Het
Mrgprb5 T C 7: 48,168,885 N34S probably benign Het
Mroh4 T C 15: 74,625,427 T182A probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo5a T C 9: 75,167,037 F743L possibly damaging Het
Notch4 A C 17: 34,583,433 D1276A probably damaging Het
Olfr139 A G 11: 74,045,047 C76R possibly damaging Het
Olfr215 T A 6: 116,582,656 I97L probably benign Het
Olfr394 A T 11: 73,888,017 Y118* probably null Het
Olfr799 T A 10: 129,647,349 C74S probably damaging Het
Plin4 T A 17: 56,106,567 T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 T827A probably benign Het
Prlr C T 15: 10,317,566 T40I probably damaging Het
Psme3 T C 11: 101,319,904 probably benign Het
Pygb A T 2: 150,815,706 D363V probably benign Het
Rsph6a C T 7: 19,054,946 Q68* probably null Het
Serpini2 A G 3: 75,258,138 V178A probably benign Het
Sh2d2a T C 3: 87,851,888 probably benign Het
Skint7 A C 4: 111,980,198 M58L probably benign Het
Slco3a1 G T 7: 74,320,553 Y435* probably null Het
Stk17b T C 1: 53,762,583 probably benign Het
Tinag T A 9: 77,031,710 H162L possibly damaging Het
Ttc21a T A 9: 119,958,799 L811Q probably damaging Het
Ttc41 A T 10: 86,759,097 M912L probably benign Het
Vmn2r98 G T 17: 19,053,613 V41F probably benign Het
Washc5 C T 15: 59,342,093 C838Y possibly damaging Het
Wrnip1 A G 13: 32,806,813 T352A probably damaging Het
Zan A C 5: 137,396,177 C4467G unknown Het
Zc3h7a T C 16: 11,152,333 probably benign Het
Zfp729a C A 13: 67,620,226 C628F probably benign Het
Other mutations in Ikzf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03149:Ikzf5 APN 7 131396765 missense probably damaging 1.00
R0583:Ikzf5 UTSW 7 131391785 splice site probably null
R1471:Ikzf5 UTSW 7 131391767 missense probably damaging 1.00
R2680:Ikzf5 UTSW 7 131396761 missense probably damaging 1.00
R4496:Ikzf5 UTSW 7 131396664 splice site probably null
R4625:Ikzf5 UTSW 7 131393753 critical splice donor site probably null
R6307:Ikzf5 UTSW 7 131391648 missense probably damaging 1.00
R6828:Ikzf5 UTSW 7 131391672 missense probably damaging 1.00
R7475:Ikzf5 UTSW 7 131392059 missense probably benign 0.31
R9733:Ikzf5 UTSW 7 131392283 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATCAGGGCAGGCATCTACATCAGG -3'
(R):5'- TTCCCCAAGTGCCAGTTGAAGC -3'

Sequencing Primer
(F):5'- GCCATAGCTTCATAGGAGTCAGTC -3'
(R):5'- AGTGCCAGTTGAAGCTGTAATG -3'
Posted On 2013-06-11