Incidental Mutation 'R5813:Map3k7'
ID447604
Institutional Source Beutler Lab
Gene Symbol Map3k7
Ensembl Gene ENSMUSG00000028284
Gene Namemitogen-activated protein kinase kinase kinase 7
SynonymsTGF-beta activated kinase 1, Tak1, transforming growth factor beta-activated kinase 1, transforming growth factor-beta-activated kinase 1, TAK1
Accession Numbers

Ncbi RefSeq: NM_009316.1, NM_172688.3; MGI:1346877

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5813 (G1)
Quality Score81
Status Not validated
Chromosome4
Chromosomal Location31964097-32023467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31964318 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 19 (I19N)
Ref Sequence ENSEMBL: ENSMUSP00000103819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037607] [ENSMUST00000080933] [ENSMUST00000108183] [ENSMUST00000108184]
Predicted Effect probably damaging
Transcript: ENSMUST00000037607
AA Change: I19N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040307
Gene: ENSMUSG00000028284
AA Change: I19N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 1.2e-61 PFAM
Pfam:Pkinase 36 285 2.8e-56 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 453 463 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 528 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000080933
AA Change: I19N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079734
Gene: ENSMUSG00000028284
AA Change: I19N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 1.7e-61 PFAM
Pfam:Pkinase 36 285 8.4e-58 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
coiled coil region 501 566 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108183
AA Change: I19N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103818
Gene: ENSMUSG00000028284
AA Change: I19N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
S_TKc 36 284 1.6e-63 SMART
low complexity region 361 375 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108184
AA Change: I19N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103819
Gene: ENSMUSG00000028284
AA Change: I19N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Pkinase_Tyr 36 284 5.6e-62 PFAM
Pfam:Pkinase 36 285 2.8e-58 PFAM
low complexity region 361 375 N/A INTRINSIC
low complexity region 453 463 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 3664194; 3608889; 3696053
Lethality: E9-E11
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis and may have impaired vascular remodeling, edema, or an open, wavy neural tube. Mice with conditional deletion in immune cells show impaired cell development and activation. [provided by MGI curators]
Allele List at MGI

All alleles(62) : Targeted(7) Gene trapped(55)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 A G 3: 89,345,828 Y230H probably benign Het
Ano7 G T 1: 93,384,919 probably null Het
Arap2 T C 5: 62,677,163 Y792C probably damaging Het
Art3 C A 5: 92,412,241 probably benign Het
Atad2 C T 15: 58,099,854 G1085D probably benign Het
Birc6 C A 17: 74,646,502 A3253E probably damaging Het
C530008M17Rik A G 5: 76,858,428 T879A unknown Het
C9 C T 15: 6,497,126 P547L probably benign Het
Cecr2 T C 6: 120,762,208 S1271P probably damaging Het
Ces1e T A 8: 93,221,677 K105* probably null Het
Cpsf4 A G 5: 145,178,873 N204S probably benign Het
Dgkz T C 2: 91,939,388 D615G possibly damaging Het
Disp1 G T 1: 183,088,410 N815K probably damaging Het
Enah A G 1: 181,931,185 probably benign Het
Fcgbp A G 7: 28,101,494 T1322A possibly damaging Het
Frem1 A G 4: 83,000,158 F516L probably damaging Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Fyco1 T C 9: 123,831,348 Y190C probably damaging Het
Gfra1 T C 19: 58,239,255 D417G probably benign Het
Gigyf2 T C 1: 87,440,763 I1055T probably damaging Het
Invs A G 4: 48,398,146 E444G probably damaging Het
Itga10 A G 3: 96,652,585 T519A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kdm2b A G 5: 122,871,868 S727P probably benign Het
Kidins220 A T 12: 25,057,140 K1531* probably null Het
Ksr1 C T 11: 79,038,198 V266M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipi T C 16: 75,573,910 R140G possibly damaging Het
Lrrc32 T C 7: 98,498,411 S133P probably damaging Het
Marf1 A G 16: 14,152,585 V90A probably benign Het
Mark3 T C 12: 111,655,443 L673P probably damaging Het
Meis1 T C 11: 19,016,229 H48R probably benign Het
Mettl26 G A 17: 25,876,021 V87M probably damaging Het
Mknk2 T C 10: 80,675,862 R5G probably benign Het
Mterf1b T C 5: 4,196,956 V199A possibly damaging Het
Ncs1 T A 2: 31,280,654 probably null Het
Nek10 T C 14: 14,986,704 V1014A probably benign Het
Notch2 A G 3: 98,135,428 N1370D probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1032 T C 2: 86,008,292 I172T probably damaging Het
Olfr922 T A 9: 38,815,656 M51K probably benign Het
Olfr952 A G 9: 39,426,736 C112R probably damaging Het
Opn5 C G 17: 42,593,006 R146T probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcyox1l C T 18: 61,699,288 probably null Het
Plxnb2 T C 15: 89,160,759 T1128A possibly damaging Het
Prex1 T C 2: 166,583,207 T960A probably benign Het
Prkaa2 A C 4: 105,036,094 *553G probably null Het
Rasgrp4 A G 7: 29,145,214 D297G probably damaging Het
Sdf4 G A 4: 155,999,399 V109I probably benign Het
Serpinb3d T C 1: 107,079,297 K227R probably benign Het
Sgsm1 A T 5: 113,250,956 I750N probably damaging Het
Shtn1 T A 19: 59,032,241 K183M probably damaging Het
Slc22a30 T C 19: 8,404,581 T109A probably benign Het
Slco1c1 A G 6: 141,542,203 D99G probably damaging Het
Soga3 G T 10: 29,150,244 V441F probably damaging Het
Tcf25 T A 8: 123,395,615 probably null Het
Tex10 A G 4: 48,452,928 V677A probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Trappc10 T A 10: 78,222,739 N136I probably damaging Het
Trpt1 T C 19: 6,998,538 F173L probably benign Het
Ttc37 A G 13: 76,155,733 T1257A probably benign Het
Ube4b G A 4: 149,337,468 R955C probably damaging Het
Usp34 C A 11: 23,421,340 P1840T probably benign Het
Vmn1r27 A T 6: 58,216,000 N6K possibly damaging Het
Wdr25 T C 12: 109,027,421 V521A possibly damaging Het
Wdr64 G A 1: 175,812,057 E1031K possibly damaging Het
Wnt10a A G 1: 74,800,596 N147S probably damaging Het
Zbed5 T C 5: 129,902,218 I336T possibly damaging Het
Zfp758 T A 17: 22,375,815 H427Q probably damaging Het
Zfp961 C A 8: 71,968,226 H194Q probably damaging Het
Other mutations in Map3k7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Map3k7 APN 4 32019539 missense probably damaging 1.00
IGL01677:Map3k7 APN 4 32017158 intron probably benign
IGL02608:Map3k7 APN 4 31981452 splice site probably benign
IGL02796:Map3k7 UTSW 4 31979692 intron probably benign
R0377:Map3k7 UTSW 4 31985731 missense probably damaging 1.00
R0498:Map3k7 UTSW 4 31974814 splice site probably benign
R1547:Map3k7 UTSW 4 31991796 missense probably benign 0.31
R2360:Map3k7 UTSW 4 31964302 missense unknown
R4709:Map3k7 UTSW 4 31985700 nonsense probably null
R4815:Map3k7 UTSW 4 31988592 missense probably damaging 0.98
R5497:Map3k7 UTSW 4 31991719 missense possibly damaging 0.56
R6349:Map3k7 UTSW 4 31988661 missense possibly damaging 0.87
R7314:Map3k7 UTSW 4 31985769 nonsense probably null
X0066:Map3k7 UTSW 4 31974848 missense probably damaging 1.00
Z1176:Map3k7 UTSW 4 32015963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAACCGGAACTGGAAGTG -3'
(R):5'- ATTGAACTGCCGACCACATAAG -3'

Sequencing Primer
(F):5'- CCGGAACTGGAAGTGTGGTG -3'
(R):5'- TGCCGACCACATAAGAATCAGGTAG -3'
Posted On2016-12-15