Incidental Mutation 'R0545:Mfhas1'
ID 44762
Institutional Source Beutler Lab
Gene Symbol Mfhas1
Ensembl Gene ENSMUSG00000070056
Gene Name malignant fibrous histiocytoma amplified sequence 1
Synonyms 2310066G09Rik, D8Ertd91e
MMRRC Submission 038737-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R0545 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 35587798-35679449 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35589048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 226 (K226E)
Ref Sequence ENSEMBL: ENSMUSP00000044135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037666]
AlphaFold Q3V1N1
Predicted Effect probably damaging
Transcript: ENSMUST00000037666
AA Change: K226E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044135
Gene: ENSMUSG00000070056
AA Change: K226E

DomainStartEndE-ValueType
LRR 58 81 1.97e1 SMART
LRR 82 105 5.72e-1 SMART
LRR 106 125 2.79e1 SMART
LRR 130 152 8.09e-1 SMART
LRR_TYP 153 175 7.78e-3 SMART
LRR 176 195 5.48e0 SMART
LRR 199 221 6.57e-1 SMART
LRR 222 244 3.98e1 SMART
LRR 245 267 1.25e-1 SMART
LRR 268 290 3.27e1 SMART
LRR 291 313 1.43e-1 SMART
LRR 314 334 1.12e1 SMART
LRR_TYP 337 360 4.11e-2 SMART
Pfam:Roc 407 537 6.9e-11 PFAM
low complexity region 743 750 N/A INTRINSIC
low complexity region 754 761 N/A INTRINSIC
low complexity region 808 820 N/A INTRINSIC
Blast:LY 1018 1038 7e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181322
Predicted Effect unknown
Transcript: ENSMUST00000209953
AA Change: K31E
Meta Mutation Damage Score 0.1177 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Identified in a human 8p amplicon, this gene is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a leucine-rich tandem repeat, which are structural or functional elements for interactions among proteins related to the cell cycle, and which suggest that overexpression might be oncogenic with respect to MFH. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,542,376 R76H probably damaging Het
4932438A13Rik G A 3: 36,987,690 probably benign Het
Adnp2 T C 18: 80,129,401 I598V probably benign Het
Ago3 T C 4: 126,417,232 N63D probably damaging Het
Alkbh7 C T 17: 56,999,012 R138* probably null Het
Atp6ap1l T C 13: 90,883,663 H300R probably benign Het
BC051076 C T 5: 87,963,490 noncoding transcript Het
Bpifb9a T A 2: 154,261,950 C104* probably null Het
Cacna2d2 T C 9: 107,525,223 L826P probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc88c T C 12: 100,947,188 D526G probably damaging Het
Cdh23 T A 10: 60,331,291 T1861S probably benign Het
Ces2f A C 8: 104,950,036 M121L possibly damaging Het
Cfap58 G A 19: 47,941,097 probably benign Het
Chpf2 T C 5: 24,590,324 S282P possibly damaging Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Cma2 A T 14: 55,973,113 M86L probably benign Het
Cog6 A T 3: 52,996,075 M134K probably damaging Het
Col1a1 A G 11: 94,951,594 D1446G unknown Het
Cpne8 T A 15: 90,497,075 D512V probably damaging Het
Ctnna2 T A 6: 77,605,182 N352I probably damaging Het
Cyp2c69 A C 19: 39,886,661 L16R probably damaging Het
Dysf T C 6: 84,099,461 S603P probably damaging Het
Epha5 A G 5: 84,067,358 probably null Het
Ercc3 T C 18: 32,245,902 S270P probably damaging Het
F10 T A 8: 13,048,249 C151S probably damaging Het
Gpr180 T G 14: 118,160,046 H317Q possibly damaging Het
Gstp2 T C 19: 4,041,633 E32G possibly damaging Het
Ikzf5 T C 7: 131,392,500 T133A possibly damaging Het
Itch G T 2: 155,182,298 G274* probably null Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Lama3 T A 18: 12,561,701 S1295T possibly damaging Het
Lipc A G 9: 70,812,705 L255P probably damaging Het
Lrrc38 A G 4: 143,350,758 D197G probably benign Het
Mfap2 A G 4: 141,014,185 probably benign Het
Morc1 A G 16: 48,565,657 R548G probably benign Het
Mrgprb5 T C 7: 48,168,885 N34S probably benign Het
Mroh4 T C 15: 74,625,427 T182A probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo5a T C 9: 75,167,037 F743L possibly damaging Het
Notch4 A C 17: 34,583,433 D1276A probably damaging Het
Olfr139 A G 11: 74,045,047 C76R possibly damaging Het
Olfr215 T A 6: 116,582,656 I97L probably benign Het
Olfr394 A T 11: 73,888,017 Y118* probably null Het
Olfr799 T A 10: 129,647,349 C74S probably damaging Het
Plin4 T A 17: 56,106,567 T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 T827A probably benign Het
Prlr C T 15: 10,317,566 T40I probably damaging Het
Psme3 T C 11: 101,319,904 probably benign Het
Pygb A T 2: 150,815,706 D363V probably benign Het
Rsph6a C T 7: 19,054,946 Q68* probably null Het
Serpini2 A G 3: 75,258,138 V178A probably benign Het
Sh2d2a T C 3: 87,851,888 probably benign Het
Skint7 A C 4: 111,980,198 M58L probably benign Het
Slco3a1 G T 7: 74,320,553 Y435* probably null Het
Stk17b T C 1: 53,762,583 probably benign Het
Tinag T A 9: 77,031,710 H162L possibly damaging Het
Ttc21a T A 9: 119,958,799 L811Q probably damaging Het
Ttc41 A T 10: 86,759,097 M912L probably benign Het
Vmn2r98 G T 17: 19,053,613 V41F probably benign Het
Washc5 C T 15: 59,342,093 C838Y possibly damaging Het
Wrnip1 A G 13: 32,806,813 T352A probably damaging Het
Zan A C 5: 137,396,177 C4467G unknown Het
Zc3h7a T C 16: 11,152,333 probably benign Het
Zfp729a C A 13: 67,620,226 C628F probably benign Het
Other mutations in Mfhas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Mfhas1 APN 8 35590771 missense probably benign 0.00
IGL00841:Mfhas1 APN 8 35590886 missense probably damaging 0.97
IGL01548:Mfhas1 APN 8 35590459 missense probably damaging 1.00
IGL02031:Mfhas1 APN 8 35589372 missense probably damaging 0.99
IGL02093:Mfhas1 APN 8 35589344 missense probably damaging 1.00
IGL02314:Mfhas1 APN 8 35588773 missense probably damaging 0.98
IGL02412:Mfhas1 APN 8 35588815 missense probably benign 0.11
IGL02638:Mfhas1 APN 8 35590950 missense possibly damaging 0.55
IGL02663:Mfhas1 APN 8 35589906 missense probably damaging 0.99
R0619:Mfhas1 UTSW 8 35590675 missense probably benign 0.00
R0637:Mfhas1 UTSW 8 35590026 nonsense probably null
R1251:Mfhas1 UTSW 8 35591053 missense probably damaging 0.97
R1829:Mfhas1 UTSW 8 35590068 missense probably benign
R1829:Mfhas1 UTSW 8 35590248 missense probably benign 0.09
R1839:Mfhas1 UTSW 8 35590858 missense possibly damaging 0.95
R1934:Mfhas1 UTSW 8 35591097 missense possibly damaging 0.52
R1937:Mfhas1 UTSW 8 35589645 missense probably damaging 0.99
R2038:Mfhas1 UTSW 8 35591277 missense probably damaging 1.00
R2982:Mfhas1 UTSW 8 35591115 missense probably benign 0.07
R4566:Mfhas1 UTSW 8 35591049 missense probably damaging 1.00
R4604:Mfhas1 UTSW 8 35588610 missense probably benign 0.00
R4693:Mfhas1 UTSW 8 35589175 missense probably damaging 1.00
R5205:Mfhas1 UTSW 8 35591007 missense probably benign 0.10
R5535:Mfhas1 UTSW 8 35590269 missense possibly damaging 0.73
R5631:Mfhas1 UTSW 8 35588419 missense probably damaging 0.96
R5744:Mfhas1 UTSW 8 35589482 missense probably damaging 1.00
R6580:Mfhas1 UTSW 8 35589265 missense probably damaging 1.00
R6663:Mfhas1 UTSW 8 35589118 missense probably damaging 1.00
R6998:Mfhas1 UTSW 8 35591356 missense probably damaging 1.00
R7046:Mfhas1 UTSW 8 35664790 missense probably benign 0.00
R7054:Mfhas1 UTSW 8 35588638 missense probably benign 0.30
R7171:Mfhas1 UTSW 8 35588992 missense probably benign 0.08
R7396:Mfhas1 UTSW 8 35590199 missense probably damaging 0.97
R7557:Mfhas1 UTSW 8 35589604 missense possibly damaging 0.50
R7853:Mfhas1 UTSW 8 35589871 nonsense probably null
R7876:Mfhas1 UTSW 8 35589543 missense probably damaging 1.00
R8815:Mfhas1 UTSW 8 35590240 missense probably damaging 0.99
R9009:Mfhas1 UTSW 8 35589955 missense probably damaging 1.00
R9214:Mfhas1 UTSW 8 35590576 missense probably damaging 1.00
R9281:Mfhas1 UTSW 8 35590797 missense probably benign 0.01
R9573:Mfhas1 UTSW 8 35676749 missense possibly damaging 0.72
R9783:Mfhas1 UTSW 8 35590780 missense probably damaging 1.00
X0060:Mfhas1 UTSW 8 35588404 missense possibly damaging 0.52
Z1088:Mfhas1 UTSW 8 35590236 missense probably benign 0.04
Z1177:Mfhas1 UTSW 8 35590385 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATCGGGGACATTGAGGTGCTGAAC -3'
(R):5'- CTGAGGTGAGCTGATTGCGACTAAG -3'

Sequencing Primer
(F):5'- AGCTGGATGTCAGCTTCAAC -3'
(R):5'- CAGCAGGGAACTCCTCGAAG -3'
Posted On 2013-06-11