Incidental Mutation 'R5813:Trappc10'
ID447636
Institutional Source Beutler Lab
Gene Symbol Trappc10
Ensembl Gene ENSMUSG00000000374
Gene Nametrafficking protein particle complex 10
SynonymsTmem1, LOC380642, B230307C21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5813 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78186725-78244641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78222739 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 136 (N136I)
Ref Sequence ENSEMBL: ENSMUSP00000000384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000384] [ENSMUST00000217980]
Predicted Effect probably damaging
Transcript: ENSMUST00000000384
AA Change: N136I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374
AA Change: N136I

DomainStartEndE-ValueType
Pfam:TRAPPC10 1016 1245 1.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217980
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular phenotypes, including atrioventricular or ventricular septal defects, thymus hypoplasia, and eye defects such as microphthalmia or anophthalmia. Holoprosencephaly, anencephaly and severe craniofacial defects may be also present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 A G 3: 89,345,828 Y230H probably benign Het
Ano7 G T 1: 93,384,919 probably null Het
Arap2 T C 5: 62,677,163 Y792C probably damaging Het
Art3 C A 5: 92,412,241 probably benign Het
Atad2 C T 15: 58,099,854 G1085D probably benign Het
Birc6 C A 17: 74,646,502 A3253E probably damaging Het
C530008M17Rik A G 5: 76,858,428 T879A unknown Het
C9 C T 15: 6,497,126 P547L probably benign Het
Cecr2 T C 6: 120,762,208 S1271P probably damaging Het
Ces1e T A 8: 93,221,677 K105* probably null Het
Cpsf4 A G 5: 145,178,873 N204S probably benign Het
Dgkz T C 2: 91,939,388 D615G possibly damaging Het
Disp1 G T 1: 183,088,410 N815K probably damaging Het
Enah A G 1: 181,931,185 probably benign Het
Fcgbp A G 7: 28,101,494 T1322A possibly damaging Het
Frem1 A G 4: 83,000,158 F516L probably damaging Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Fyco1 T C 9: 123,831,348 Y190C probably damaging Het
Gfra1 T C 19: 58,239,255 D417G probably benign Het
Gigyf2 T C 1: 87,440,763 I1055T probably damaging Het
Invs A G 4: 48,398,146 E444G probably damaging Het
Itga10 A G 3: 96,652,585 T519A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kdm2b A G 5: 122,871,868 S727P probably benign Het
Kidins220 A T 12: 25,057,140 K1531* probably null Het
Ksr1 C T 11: 79,038,198 V266M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipi T C 16: 75,573,910 R140G possibly damaging Het
Lrrc32 T C 7: 98,498,411 S133P probably damaging Het
Map3k7 T A 4: 31,964,318 I19N probably damaging Het
Marf1 A G 16: 14,152,585 V90A probably benign Het
Mark3 T C 12: 111,655,443 L673P probably damaging Het
Meis1 T C 11: 19,016,229 H48R probably benign Het
Mettl26 G A 17: 25,876,021 V87M probably damaging Het
Mknk2 T C 10: 80,675,862 R5G probably benign Het
Mterf1b T C 5: 4,196,956 V199A possibly damaging Het
Ncs1 T A 2: 31,280,654 probably null Het
Nek10 T C 14: 14,986,704 V1014A probably benign Het
Notch2 A G 3: 98,135,428 N1370D probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1032 T C 2: 86,008,292 I172T probably damaging Het
Olfr922 T A 9: 38,815,656 M51K probably benign Het
Olfr952 A G 9: 39,426,736 C112R probably damaging Het
Opn5 C G 17: 42,593,006 R146T probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcyox1l C T 18: 61,699,288 probably null Het
Plxnb2 T C 15: 89,160,759 T1128A possibly damaging Het
Prex1 T C 2: 166,583,207 T960A probably benign Het
Prkaa2 A C 4: 105,036,094 *553G probably null Het
Rasgrp4 A G 7: 29,145,214 D297G probably damaging Het
Sdf4 G A 4: 155,999,399 V109I probably benign Het
Serpinb3d T C 1: 107,079,297 K227R probably benign Het
Sgsm1 A T 5: 113,250,956 I750N probably damaging Het
Shtn1 T A 19: 59,032,241 K183M probably damaging Het
Slc22a30 T C 19: 8,404,581 T109A probably benign Het
Slco1c1 A G 6: 141,542,203 D99G probably damaging Het
Soga3 G T 10: 29,150,244 V441F probably damaging Het
Tcf25 T A 8: 123,395,615 probably null Het
Tex10 A G 4: 48,452,928 V677A probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Trpt1 T C 19: 6,998,538 F173L probably benign Het
Ttc37 A G 13: 76,155,733 T1257A probably benign Het
Ube4b G A 4: 149,337,468 R955C probably damaging Het
Usp34 C A 11: 23,421,340 P1840T probably benign Het
Vmn1r27 A T 6: 58,216,000 N6K possibly damaging Het
Wdr25 T C 12: 109,027,421 V521A possibly damaging Het
Wdr64 G A 1: 175,812,057 E1031K possibly damaging Het
Wnt10a A G 1: 74,800,596 N147S probably damaging Het
Zbed5 T C 5: 129,902,218 I336T possibly damaging Het
Zfp758 T A 17: 22,375,815 H427Q probably damaging Het
Zfp961 C A 8: 71,968,226 H194Q probably damaging Het
Other mutations in Trappc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Trappc10 APN 10 78203877 splice site probably benign
IGL01375:Trappc10 APN 10 78188899 missense possibly damaging 0.75
IGL01413:Trappc10 APN 10 78197844 missense possibly damaging 0.87
IGL02413:Trappc10 APN 10 78210776 missense probably damaging 0.99
IGL03037:Trappc10 APN 10 78199035 unclassified probably benign
IGL03094:Trappc10 APN 10 78228920 splice site probably benign
IGL03164:Trappc10 APN 10 78220242 missense probably damaging 1.00
IGL03351:Trappc10 APN 10 78188761 missense probably damaging 1.00
IGL03055:Trappc10 UTSW 10 78214686 missense probably damaging 1.00
IGL03098:Trappc10 UTSW 10 78214686 missense probably damaging 1.00
R0304:Trappc10 UTSW 10 78210760 splice site probably benign
R0605:Trappc10 UTSW 10 78201497 missense possibly damaging 0.70
R1806:Trappc10 UTSW 10 78210776 missense probably damaging 0.99
R1856:Trappc10 UTSW 10 78196451 missense probably benign 0.00
R2045:Trappc10 UTSW 10 78209479 splice site probably benign
R2088:Trappc10 UTSW 10 78196334 missense probably benign 0.00
R2126:Trappc10 UTSW 10 78203924 missense possibly damaging 0.94
R2202:Trappc10 UTSW 10 78199042 critical splice donor site probably null
R2509:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2510:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2511:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2893:Trappc10 UTSW 10 78193401 missense probably benign 0.00
R3744:Trappc10 UTSW 10 78199090 missense probably benign 0.00
R3778:Trappc10 UTSW 10 78200802 missense possibly damaging 0.89
R3876:Trappc10 UTSW 10 78220186 splice site probably null
R3930:Trappc10 UTSW 10 78210403 missense probably benign 0.03
R4078:Trappc10 UTSW 10 78210382 missense probably damaging 1.00
R4111:Trappc10 UTSW 10 78196430 missense probably benign 0.09
R4418:Trappc10 UTSW 10 78217188 missense probably damaging 1.00
R4549:Trappc10 UTSW 10 78231458 missense probably damaging 1.00
R4695:Trappc10 UTSW 10 78197863 missense probably damaging 0.99
R4799:Trappc10 UTSW 10 78201590 missense possibly damaging 0.71
R5022:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5023:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5026:Trappc10 UTSW 10 78204288 missense possibly damaging 0.82
R5057:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5282:Trappc10 UTSW 10 78187860 missense probably damaging 1.00
R5363:Trappc10 UTSW 10 78188840 missense possibly damaging 0.92
R5831:Trappc10 UTSW 10 78209426 missense probably damaging 1.00
R6209:Trappc10 UTSW 10 78214812 missense possibly damaging 0.50
R6450:Trappc10 UTSW 10 78209450 missense possibly damaging 0.92
R6520:Trappc10 UTSW 10 78201453 missense probably benign 0.00
R6533:Trappc10 UTSW 10 78188894 missense probably damaging 0.96
R6767:Trappc10 UTSW 10 78193511 missense possibly damaging 0.75
R6798:Trappc10 UTSW 10 78188831 missense probably benign 0.00
R7205:Trappc10 UTSW 10 78210428 missense probably damaging 1.00
R7282:Trappc10 UTSW 10 78207493 missense probably damaging 0.98
R7378:Trappc10 UTSW 10 78193418 missense probably damaging 0.96
R7384:Trappc10 UTSW 10 78209384 missense possibly damaging 0.85
R7770:Trappc10 UTSW 10 78210845 missense probably damaging 0.96
R7829:Trappc10 UTSW 10 78199075 missense probably benign
R7839:Trappc10 UTSW 10 78188812 missense possibly damaging 0.84
R7922:Trappc10 UTSW 10 78188812 missense possibly damaging 0.84
Z1177:Trappc10 UTSW 10 78217153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGGAGATGAACTGCTAGG -3'
(R):5'- CTGTTCCTAGAGACAAAGGGG -3'

Sequencing Primer
(F):5'- TGAACTGCTAGGCCAGGAATTAC -3'
(R):5'- TGTTCCTAGAGACAAAGGGGCATTG -3'
Posted On2016-12-15