Mutagenetix > Incidental Mutations

Incidental Mutation 'R5813:Usp34'

447638

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.605) question?

Stock #

R5813 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 23421340 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 1840 (P1840T)

Ref Sequence

ENSEMBL: ENSMUSP00000137430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000130131] [ENSMUST00000180046]

Predicted Effect

probably benign
Transcript: ENSMUST00000130131
AA Change: P81T

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000115168
Gene: ENSMUSG00000056342
AA Change: P81T

Domain	Start	End	E-Value	Type
low complexity region	33	45	N/A	INTRINSIC
Pfam:UCH	171	514	1.1e-48	PFAM
Pfam:UCH_1	172	470	1.6e-25	PFAM
low complexity region	763	785	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137823
AA Change: P1859T

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: P1859T

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155984

Predicted Effect

probably benign
Transcript: ENSMUST00000180046
AA Change: P1840T

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: P1840T

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	A	G	3: 89,345,828	Y230H	probably benign	Het
Ano7	G	T	1: 93,384,919		probably null	Het
Arap2	T	C	5: 62,677,163	Y792C	probably damaging	Het
Art3	C	A	5: 92,412,241		probably benign	Het
Atad2	C	T	15: 58,099,854	G1085D	probably benign	Het
Birc6	C	A	17: 74,646,502	A3253E	probably damaging	Het
C530008M17Rik	A	G	5: 76,858,428	T879A	unknown	Het
C9	C	T	15: 6,497,126	P547L	probably benign	Het
Cecr2	T	C	6: 120,762,208	S1271P	probably damaging	Het
Ces1e	T	A	8: 93,221,677	K105*	probably null	Het
Cpsf4	A	G	5: 145,178,873	N204S	probably benign	Het
Dgkz	T	C	2: 91,939,388	D615G	possibly damaging	Het
Disp1	G	T	1: 183,088,410	N815K	probably damaging	Het
Enah	A	G	1: 181,931,185		probably benign	Het
Fcgbp	A	G	7: 28,101,494	T1322A	possibly damaging	Het
Frem1	A	G	4: 83,000,158	F516L	probably damaging	Het
Fry	G	A	5: 150,399,671	A1096T	probably damaging	Het
Fyco1	T	C	9: 123,831,348	Y190C	probably damaging	Het
Gfra1	T	C	19: 58,239,255	D417G	probably benign	Het
Gigyf2	T	C	1: 87,440,763	I1055T	probably damaging	Het
Invs	A	G	4: 48,398,146	E444G	probably damaging	Het
Itga10	A	G	3: 96,652,585	T519A	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kdm2b	A	G	5: 122,871,868	S727P	probably benign	Het
Kidins220	A	T	12: 25,057,140	K1531*	probably null	Het
Ksr1	C	T	11: 79,038,198	V266M	probably damaging	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lipi	T	C	16: 75,573,910	R140G	possibly damaging	Het
Lrrc32	T	C	7: 98,498,411	S133P	probably damaging	Het
Map3k7	T	A	4: 31,964,318	I19N	probably damaging	Het
Marf1	A	G	16: 14,152,585	V90A	probably benign	Het
Mark3	T	C	12: 111,655,443	L673P	probably damaging	Het
Meis1	T	C	11: 19,016,229	H48R	probably benign	Het
Mettl26	G	A	17: 25,876,021	V87M	probably damaging	Het
Mknk2	T	C	10: 80,675,862	R5G	probably benign	Het
Mterf1b	T	C	5: 4,196,956	V199A	possibly damaging	Het
Ncs1	T	A	2: 31,280,654		probably null	Het
Nek10	T	C	14: 14,986,704	V1014A	probably benign	Het
Notch2	A	G	3: 98,135,428	N1370D	probably benign	Het
Nr2e3	TCCATCGGAGTGTTCCC	TC	9: 59,943,418		probably benign	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1032	T	C	2: 86,008,292	I172T	probably damaging	Het
Olfr922	T	A	9: 38,815,656	M51K	probably benign	Het
Olfr952	A	G	9: 39,426,736	C112R	probably damaging	Het
Opn5	C	G	17: 42,593,006	R146T	probably damaging	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Pcyox1l	C	T	18: 61,699,288		probably null	Het
Plxnb2	T	C	15: 89,160,759	T1128A	possibly damaging	Het
Prex1	T	C	2: 166,583,207	T960A	probably benign	Het
Prkaa2	A	C	4: 105,036,094	*553G	probably null	Het
Rasgrp4	A	G	7: 29,145,214	D297G	probably damaging	Het
Sdf4	G	A	4: 155,999,399	V109I	probably benign	Het
Serpinb3d	T	C	1: 107,079,297	K227R	probably benign	Het
Sgsm1	A	T	5: 113,250,956	I750N	probably damaging	Het
Shtn1	T	A	19: 59,032,241	K183M	probably damaging	Het
Slc22a30	T	C	19: 8,404,581	T109A	probably benign	Het
Slco1c1	A	G	6: 141,542,203	D99G	probably damaging	Het
Soga3	G	T	10: 29,150,244	V441F	probably damaging	Het
Tcf25	T	A	8: 123,395,615		probably null	Het
Tex10	A	G	4: 48,452,928	V677A	probably benign	Het
Tmem131l	A	G	3: 83,940,572	S329P	probably benign	Het
Trappc10	T	A	10: 78,222,739	N136I	probably damaging	Het
Trpt1	T	C	19: 6,998,538	F173L	probably benign	Het
Ttc37	A	G	13: 76,155,733	T1257A	probably benign	Het
Ube4b	G	A	4: 149,337,468	R955C	probably damaging	Het
Vmn1r27	A	T	6: 58,216,000	N6K	possibly damaging	Het
Wdr25	T	C	12: 109,027,421	V521A	possibly damaging	Het
Wdr64	G	A	1: 175,812,057	E1031K	possibly damaging	Het
Wnt10a	A	G	1: 74,800,596	N147S	probably damaging	Het
Zbed5	T	C	5: 129,902,218	I336T	possibly damaging	Het
Zfp758	T	A	17: 22,375,815	H427Q	probably damaging	Het
Zfp961	C	A	8: 71,968,226	H194Q	probably damaging	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	synonymous	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
R7777:Usp34	UTSW	11	23382638	missense
R7810:Usp34	UTSW	11	23412314	missense
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- ATTTGGCTGACTGTATTCGCAG -3'
(R):5'- GGACATTCCCCTGAGTAACAG -3'

Sequencing Primer
(F):5'- GCTGACTGTATTCGCAGGTAAAAATC -3'
(R):5'- GCAAACATGGCTTGGATA -3'

Posted On

2016-12-15