Incidental Mutation 'R5813:Plxnb2'
ID447648
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Nameplexin B2
SynonymsDebt, 1110007H23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R5813 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89155549-89180788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89160759 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1128 (T1128A)
Ref Sequence ENSEMBL: ENSMUSP00000051731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060808
AA Change: T1128A

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: T1128A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109331
AA Change: T1128A

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: T1128A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230393
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 A G 3: 89,345,828 Y230H probably benign Het
Ano7 G T 1: 93,384,919 probably null Het
Arap2 T C 5: 62,677,163 Y792C probably damaging Het
Art3 C A 5: 92,412,241 probably benign Het
Atad2 C T 15: 58,099,854 G1085D probably benign Het
Birc6 C A 17: 74,646,502 A3253E probably damaging Het
C530008M17Rik A G 5: 76,858,428 T879A unknown Het
C9 C T 15: 6,497,126 P547L probably benign Het
Cecr2 T C 6: 120,762,208 S1271P probably damaging Het
Ces1e T A 8: 93,221,677 K105* probably null Het
Cpsf4 A G 5: 145,178,873 N204S probably benign Het
Dgkz T C 2: 91,939,388 D615G possibly damaging Het
Disp1 G T 1: 183,088,410 N815K probably damaging Het
Enah A G 1: 181,931,185 probably benign Het
Fcgbp A G 7: 28,101,494 T1322A possibly damaging Het
Frem1 A G 4: 83,000,158 F516L probably damaging Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Fyco1 T C 9: 123,831,348 Y190C probably damaging Het
Gfra1 T C 19: 58,239,255 D417G probably benign Het
Gigyf2 T C 1: 87,440,763 I1055T probably damaging Het
Invs A G 4: 48,398,146 E444G probably damaging Het
Itga10 A G 3: 96,652,585 T519A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kdm2b A G 5: 122,871,868 S727P probably benign Het
Kidins220 A T 12: 25,057,140 K1531* probably null Het
Ksr1 C T 11: 79,038,198 V266M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipi T C 16: 75,573,910 R140G possibly damaging Het
Lrrc32 T C 7: 98,498,411 S133P probably damaging Het
Map3k7 T A 4: 31,964,318 I19N probably damaging Het
Marf1 A G 16: 14,152,585 V90A probably benign Het
Mark3 T C 12: 111,655,443 L673P probably damaging Het
Meis1 T C 11: 19,016,229 H48R probably benign Het
Mettl26 G A 17: 25,876,021 V87M probably damaging Het
Mknk2 T C 10: 80,675,862 R5G probably benign Het
Mterf1b T C 5: 4,196,956 V199A possibly damaging Het
Ncs1 T A 2: 31,280,654 probably null Het
Nek10 T C 14: 14,986,704 V1014A probably benign Het
Notch2 A G 3: 98,135,428 N1370D probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1032 T C 2: 86,008,292 I172T probably damaging Het
Olfr922 T A 9: 38,815,656 M51K probably benign Het
Olfr952 A G 9: 39,426,736 C112R probably damaging Het
Opn5 C G 17: 42,593,006 R146T probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcyox1l C T 18: 61,699,288 probably null Het
Prex1 T C 2: 166,583,207 T960A probably benign Het
Prkaa2 A C 4: 105,036,094 *553G probably null Het
Rasgrp4 A G 7: 29,145,214 D297G probably damaging Het
Sdf4 G A 4: 155,999,399 V109I probably benign Het
Serpinb3d T C 1: 107,079,297 K227R probably benign Het
Sgsm1 A T 5: 113,250,956 I750N probably damaging Het
Shtn1 T A 19: 59,032,241 K183M probably damaging Het
Slc22a30 T C 19: 8,404,581 T109A probably benign Het
Slco1c1 A G 6: 141,542,203 D99G probably damaging Het
Soga3 G T 10: 29,150,244 V441F probably damaging Het
Tcf25 T A 8: 123,395,615 probably null Het
Tex10 A G 4: 48,452,928 V677A probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Trappc10 T A 10: 78,222,739 N136I probably damaging Het
Trpt1 T C 19: 6,998,538 F173L probably benign Het
Ttc37 A G 13: 76,155,733 T1257A probably benign Het
Ube4b G A 4: 149,337,468 R955C probably damaging Het
Usp34 C A 11: 23,421,340 P1840T probably benign Het
Vmn1r27 A T 6: 58,216,000 N6K possibly damaging Het
Wdr25 T C 12: 109,027,421 V521A possibly damaging Het
Wdr64 G A 1: 175,812,057 E1031K possibly damaging Het
Wnt10a A G 1: 74,800,596 N147S probably damaging Het
Zbed5 T C 5: 129,902,218 I336T possibly damaging Het
Zfp758 T A 17: 22,375,815 H427Q probably damaging Het
Zfp961 C A 8: 71,968,226 H194Q probably damaging Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
R7513:Plxnb2 UTSW 15 89158322 critical splice acceptor site probably null
R7522:Plxnb2 UTSW 15 89161774 missense probably benign 0.20
R7730:Plxnb2 UTSW 15 89162330 missense probably benign
R7766:Plxnb2 UTSW 15 89161271 missense probably benign 0.01
R7781:Plxnb2 UTSW 15 89157022 missense possibly damaging 0.89
R8126:Plxnb2 UTSW 15 89163303 missense probably benign
R8131:Plxnb2 UTSW 15 89158713 missense probably damaging 1.00
R8372:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R8736:Plxnb2 UTSW 15 89162058 missense probably damaging 1.00
R8772:Plxnb2 UTSW 15 89162746 missense probably damaging 1.00
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Z1177:Plxnb2 UTSW 15 89159096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACCTGTGTGGAAGCTAGGG -3'
(R):5'- TTGAGAACTTCACGGGTGGC -3'

Sequencing Primer
(F):5'- TTCTCCTGAGAGGCTCCCCAG -3'
(R):5'- CTTCACGGGTGGCGTCAAAAAG -3'
Posted On2016-12-15