Mutagenetix > Incidental Mutation

Incidental Mutation 'R0545:Myo5a'

44765

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

MMRRC Submission

038737-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R0545 (G1)

Quality Score

211

Status

Validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75167037 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 743 (F743L)

Ref Sequence

ENSEMBL: ENSMUSP00000116028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]

AlphaFold

Q99104

PDB Structure

Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123128
AA Change: F743L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: F743L

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123531

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136731
AA Change: F743L

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: F743L

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000155282
AA Change: F743L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: F743L

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Meta Mutation Damage Score

0.2555

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.9%
20x: 94.0%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	C	T	2: 19,542,376	R76H	probably damaging	Het
4932438A13Rik	G	A	3: 36,987,690		probably benign	Het
Adnp2	T	C	18: 80,129,401	I598V	probably benign	Het
Ago3	T	C	4: 126,417,232	N63D	probably damaging	Het
Alkbh7	C	T	17: 56,999,012	R138*	probably null	Het
Atp6ap1l	T	C	13: 90,883,663	H300R	probably benign	Het
BC051076	C	T	5: 87,963,490		noncoding transcript	Het
Bpifb9a	T	A	2: 154,261,950	C104*	probably null	Het
Cacna2d2	T	C	9: 107,525,223	L826P	probably damaging	Het
Car5b	G	A	X: 163,979,301	R282C	probably damaging	Het
Ccdc88c	T	C	12: 100,947,188	D526G	probably damaging	Het
Cdh23	T	A	10: 60,331,291	T1861S	probably benign	Het
Ces2f	A	C	8: 104,950,036	M121L	possibly damaging	Het
Cfap58	G	A	19: 47,941,097		probably benign	Het
Chpf2	T	C	5: 24,590,324	S282P	possibly damaging	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Cma2	A	T	14: 55,973,113	M86L	probably benign	Het
Cog6	A	T	3: 52,996,075	M134K	probably damaging	Het
Col1a1	A	G	11: 94,951,594	D1446G	unknown	Het
Cpne8	T	A	15: 90,497,075	D512V	probably damaging	Het
Ctnna2	T	A	6: 77,605,182	N352I	probably damaging	Het
Cyp2c69	A	C	19: 39,886,661	L16R	probably damaging	Het
Dysf	T	C	6: 84,099,461	S603P	probably damaging	Het
Epha5	A	G	5: 84,067,358		probably null	Het
Ercc3	T	C	18: 32,245,902	S270P	probably damaging	Het
F10	T	A	8: 13,048,249	C151S	probably damaging	Het
Gpr180	T	G	14: 118,160,046	H317Q	possibly damaging	Het
Gstp2	T	C	19: 4,041,633	E32G	possibly damaging	Het
Ikzf5	T	C	7: 131,392,500	T133A	possibly damaging	Het
Itch	G	T	2: 155,182,298	G274*	probably null	Het
Jarid2	T	A	13: 44,902,831	N365K	probably benign	Het
Lama3	T	A	18: 12,561,701	S1295T	possibly damaging	Het
Lipc	A	G	9: 70,812,705	L255P	probably damaging	Het
Lrrc38	A	G	4: 143,350,758	D197G	probably benign	Het
Mfap2	A	G	4: 141,014,185		probably benign	Het
Mfhas1	A	G	8: 35,589,048	K226E	probably damaging	Het
Morc1	A	G	16: 48,565,657	R548G	probably benign	Het
Mrgprb5	T	C	7: 48,168,885	N34S	probably benign	Het
Mroh4	T	C	15: 74,625,427	T182A	probably benign	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Notch4	A	C	17: 34,583,433	D1276A	probably damaging	Het
Olfr139	A	G	11: 74,045,047	C76R	possibly damaging	Het
Olfr215	T	A	6: 116,582,656	I97L	probably benign	Het
Olfr394	A	T	11: 73,888,017	Y118*	probably null	Het
Olfr799	T	A	10: 129,647,349	C74S	probably damaging	Het
Plin4	T	A	17: 56,106,567	T353S	probably damaging	Het
Ppp1r9a	A	G	6: 5,115,357	T827A	probably benign	Het
Prlr	C	T	15: 10,317,566	T40I	probably damaging	Het
Psme3	T	C	11: 101,319,904		probably benign	Het
Pygb	A	T	2: 150,815,706	D363V	probably benign	Het
Rsph6a	C	T	7: 19,054,946	Q68*	probably null	Het
Serpini2	A	G	3: 75,258,138	V178A	probably benign	Het
Sh2d2a	T	C	3: 87,851,888		probably benign	Het
Skint7	A	C	4: 111,980,198	M58L	probably benign	Het
Slco3a1	G	T	7: 74,320,553	Y435*	probably null	Het
Stk17b	T	C	1: 53,762,583		probably benign	Het
Tinag	T	A	9: 77,031,710	H162L	possibly damaging	Het
Ttc21a	T	A	9: 119,958,799	L811Q	probably damaging	Het
Ttc41	A	T	10: 86,759,097	M912L	probably benign	Het
Vmn2r98	G	T	17: 19,053,613	V41F	probably benign	Het
Washc5	C	T	15: 59,342,093	C838Y	possibly damaging	Het
Wrnip1	A	G	13: 32,806,813	T352A	probably damaging	Het
Zan	A	C	5: 137,396,177	C4467G	unknown	Het
Zc3h7a	T	C	16: 11,152,333		probably benign	Het
Zfp729a	C	A	13: 67,620,226	C628F	probably benign	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211127	missense	probably damaging	1.00
IGL02988:Myo5a	UTSW	9	75130141	splice site	probably benign
IGL03050:Myo5a	UTSW	9	75146909	splice site	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R0601:Myo5a	UTSW	9	75174015	missense	probably benign	0.01
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1548:Myo5a	UTSW	9	75171746	missense	probably damaging	1.00
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1924:Myo5a	UTSW	9	75116207	missense	probably damaging	1.00
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2201:Myo5a	UTSW	9	75217943	missense	possibly damaging	0.51
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75123040	missense	probably damaging	1.00
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	splice site	probably null
R4577:Myo5a	UTSW	9	75217545	missense	probably damaging	1.00
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4767:Myo5a	UTSW	9	75144076	missense	probably damaging	0.99
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5254:Myo5a	UTSW	9	75130120	missense	probably damaging	1.00
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R5964:Myo5a	UTSW	9	75203833	missense	probably benign	0.09
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6644:Myo5a	UTSW	9	75146967	missense	probably damaging	0.98
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7219:Myo5a	UTSW	9	75120770	missense	probably damaging	1.00
R7497:Myo5a	UTSW	9	75197701	missense
R7620:Myo5a	UTSW	9	75164136	missense	probably benign	0.41
R7719:Myo5a	UTSW	9	75144084	missense	probably benign	0.01
R7810:Myo5a	UTSW	9	75160465	missense	probably benign	0.09
R7810:Myo5a	UTSW	9	75169010	missense	probably benign
R7866:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R7939:Myo5a	UTSW	9	75189900	missense
R8050:Myo5a	UTSW	9	75181946	missense	probably damaging	0.99
R8061:Myo5a	UTSW	9	75122957	nonsense	probably null
R8326:Myo5a	UTSW	9	75217989	missense	probably damaging	0.98
R8529:Myo5a	UTSW	9	75212872	missense	probably benign	0.02
R8824:Myo5a	UTSW	9	75167046	missense	probably damaging	1.00
R8858:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9040:Myo5a	UTSW	9	75174059	missense	probably benign	0.07
R9092:Myo5a	UTSW	9	75147132	critical splice donor site	probably null
R9249:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9274:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9293:Myo5a	UTSW	9	75180030	missense	probably benign	0.37
R9366:Myo5a	UTSW	9	75217518	missense	probably damaging	0.98
R9410:Myo5a	UTSW	9	75116214	missense	probably damaging	0.98
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00
Z1177:Myo5a	UTSW	9	75186036	missense

Predicted Primers

PCR Primer
(F):5'- TCAGTCAGAGGGAGTGTCAGCATC -3'
(R):5'- AGACTTACCATCGAGCCTGATAGCC -3'

Sequencing Primer
(F):5'- TGGGCCTCAGATAATAATTCCAGG -3'
(R):5'- ATAGCCCCGCACGTATCG -3'

Posted On

2013-06-11