Incidental Mutation 'R5813:Opn5'
ID447653
Institutional Source Beutler Lab
Gene Symbol Opn5
Ensembl Gene ENSMUSG00000043972
Gene Nameopsin 5
SynonymsGpr136, Neuropsin, TMEM13, PGR12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5813 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location42556783-42611313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 42593006 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Threonine at position 146 (R146T)
Ref Sequence ENSEMBL: ENSMUSP00000063542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068355]
Predicted Effect probably damaging
Transcript: ENSMUST00000068355
AA Change: R146T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063542
Gene: ENSMUSG00000043972
AA Change: R146T

DomainStartEndE-ValueType
Pfam:7tm_1 50 306 3.4e-41 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. This opsin gene is expressed in the eye, brain, testes, and spinal cord. This gene belongs to the seven-exon subfamily of mammalian opsin genes that includes peropsin (RRH) and retinal G protein coupled receptor (RGR). Like these other seven-exon opsin genes, this family member may encode a protein with photoisomerase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit light/dark entrainment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 A G 3: 89,345,828 Y230H probably benign Het
Ano7 G T 1: 93,384,919 probably null Het
Arap2 T C 5: 62,677,163 Y792C probably damaging Het
Art3 C A 5: 92,412,241 probably benign Het
Atad2 C T 15: 58,099,854 G1085D probably benign Het
Birc6 C A 17: 74,646,502 A3253E probably damaging Het
C530008M17Rik A G 5: 76,858,428 T879A unknown Het
C9 C T 15: 6,497,126 P547L probably benign Het
Cecr2 T C 6: 120,762,208 S1271P probably damaging Het
Ces1e T A 8: 93,221,677 K105* probably null Het
Cpsf4 A G 5: 145,178,873 N204S probably benign Het
Dgkz T C 2: 91,939,388 D615G possibly damaging Het
Disp1 G T 1: 183,088,410 N815K probably damaging Het
Enah A G 1: 181,931,185 probably benign Het
Fcgbp A G 7: 28,101,494 T1322A possibly damaging Het
Frem1 A G 4: 83,000,158 F516L probably damaging Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Fyco1 T C 9: 123,831,348 Y190C probably damaging Het
Gfra1 T C 19: 58,239,255 D417G probably benign Het
Gigyf2 T C 1: 87,440,763 I1055T probably damaging Het
Invs A G 4: 48,398,146 E444G probably damaging Het
Itga10 A G 3: 96,652,585 T519A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kdm2b A G 5: 122,871,868 S727P probably benign Het
Kidins220 A T 12: 25,057,140 K1531* probably null Het
Ksr1 C T 11: 79,038,198 V266M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipi T C 16: 75,573,910 R140G possibly damaging Het
Lrrc32 T C 7: 98,498,411 S133P probably damaging Het
Map3k7 T A 4: 31,964,318 I19N probably damaging Het
Marf1 A G 16: 14,152,585 V90A probably benign Het
Mark3 T C 12: 111,655,443 L673P probably damaging Het
Meis1 T C 11: 19,016,229 H48R probably benign Het
Mettl26 G A 17: 25,876,021 V87M probably damaging Het
Mknk2 T C 10: 80,675,862 R5G probably benign Het
Mterf1b T C 5: 4,196,956 V199A possibly damaging Het
Ncs1 T A 2: 31,280,654 probably null Het
Nek10 T C 14: 14,986,704 V1014A probably benign Het
Notch2 A G 3: 98,135,428 N1370D probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1032 T C 2: 86,008,292 I172T probably damaging Het
Olfr922 T A 9: 38,815,656 M51K probably benign Het
Olfr952 A G 9: 39,426,736 C112R probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcyox1l C T 18: 61,699,288 probably null Het
Plxnb2 T C 15: 89,160,759 T1128A possibly damaging Het
Prex1 T C 2: 166,583,207 T960A probably benign Het
Prkaa2 A C 4: 105,036,094 *553G probably null Het
Rasgrp4 A G 7: 29,145,214 D297G probably damaging Het
Sdf4 G A 4: 155,999,399 V109I probably benign Het
Serpinb3d T C 1: 107,079,297 K227R probably benign Het
Sgsm1 A T 5: 113,250,956 I750N probably damaging Het
Shtn1 T A 19: 59,032,241 K183M probably damaging Het
Slc22a30 T C 19: 8,404,581 T109A probably benign Het
Slco1c1 A G 6: 141,542,203 D99G probably damaging Het
Soga3 G T 10: 29,150,244 V441F probably damaging Het
Tcf25 T A 8: 123,395,615 probably null Het
Tex10 A G 4: 48,452,928 V677A probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Trappc10 T A 10: 78,222,739 N136I probably damaging Het
Trpt1 T C 19: 6,998,538 F173L probably benign Het
Ttc37 A G 13: 76,155,733 T1257A probably benign Het
Ube4b G A 4: 149,337,468 R955C probably damaging Het
Usp34 C A 11: 23,421,340 P1840T probably benign Het
Vmn1r27 A T 6: 58,216,000 N6K possibly damaging Het
Wdr25 T C 12: 109,027,421 V521A possibly damaging Het
Wdr64 G A 1: 175,812,057 E1031K possibly damaging Het
Wnt10a A G 1: 74,800,596 N147S probably damaging Het
Zbed5 T C 5: 129,902,218 I336T possibly damaging Het
Zfp758 T A 17: 22,375,815 H427Q probably damaging Het
Zfp961 C A 8: 71,968,226 H194Q probably damaging Het
Other mutations in Opn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Opn5 APN 17 42611228 missense probably damaging 1.00
IGL01372:Opn5 APN 17 42580544 splice site probably null
IGL01554:Opn5 APN 17 42607198 missense probably damaging 0.99
IGL02363:Opn5 APN 17 42557491 missense probably benign
IGL02421:Opn5 APN 17 42596555 splice site probably benign
IGL02720:Opn5 APN 17 42596626 missense probably damaging 1.00
K7371:Opn5 UTSW 17 42580631 missense probably damaging 1.00
R0063:Opn5 UTSW 17 42596626 missense probably damaging 1.00
R0220:Opn5 UTSW 17 42596604 missense probably benign 0.04
R0505:Opn5 UTSW 17 42592953 missense possibly damaging 0.88
R0971:Opn5 UTSW 17 42611327 unclassified probably null
R2035:Opn5 UTSW 17 42607161 missense probably damaging 0.97
R4723:Opn5 UTSW 17 42607200 missense probably damaging 1.00
R4830:Opn5 UTSW 17 42611296 missense probably benign 0.00
R4874:Opn5 UTSW 17 42580719 missense probably damaging 1.00
R4955:Opn5 UTSW 17 42611238 missense probably damaging 1.00
R5924:Opn5 UTSW 17 42611308 start codon destroyed probably null 0.95
R6478:Opn5 UTSW 17 42580749 missense probably benign 0.06
R7831:Opn5 UTSW 17 42580619 missense probably null 0.85
R7914:Opn5 UTSW 17 42580619 missense probably null 0.85
Z1177:Opn5 UTSW 17 42596599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGAAAACAATCACAGCCGTTG -3'
(R):5'- GGAACTTTCCCTGCCTTGAC -3'

Sequencing Primer
(F):5'- CCGTTGGCAGCAGGAGG -3'
(R):5'- GACTTCACTCTCCCCCAGG -3'
Posted On2016-12-15