Incidental Mutation 'R0545:Tinag'
ID44766
Institutional Source Beutler Lab
Gene Symbol Tinag
Ensembl Gene ENSMUSG00000032357
Gene Nametubulointerstitial nephritis antigen
SynonymsTIN-ag
MMRRC Submission 038737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R0545 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location76951693-77045794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77031710 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 162 (H162L)
Ref Sequence ENSEMBL: ENSMUSP00000139155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]
Predicted Effect probably benign
Transcript: ENSMUST00000034911
AA Change: H162L

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: H162L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Pept_C1 216 466 1.83e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184897
AA Change: H162L

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357
AA Change: H162L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,542,376 R76H probably damaging Het
4932438A13Rik G A 3: 36,987,690 probably benign Het
Adnp2 T C 18: 80,129,401 I598V probably benign Het
Ago3 T C 4: 126,417,232 N63D probably damaging Het
Alkbh7 C T 17: 56,999,012 R138* probably null Het
Atp6ap1l T C 13: 90,883,663 H300R probably benign Het
BC051076 C T 5: 87,963,490 noncoding transcript Het
Bpifb9a T A 2: 154,261,950 C104* probably null Het
Cacna2d2 T C 9: 107,525,223 L826P probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc88c T C 12: 100,947,188 D526G probably damaging Het
Cdh23 T A 10: 60,331,291 T1861S probably benign Het
Ces2f A C 8: 104,950,036 M121L possibly damaging Het
Cfap58 G A 19: 47,941,097 probably benign Het
Chpf2 T C 5: 24,590,324 S282P possibly damaging Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Cma2 A T 14: 55,973,113 M86L probably benign Het
Cog6 A T 3: 52,996,075 M134K probably damaging Het
Col1a1 A G 11: 94,951,594 D1446G unknown Het
Cpne8 T A 15: 90,497,075 D512V probably damaging Het
Ctnna2 T A 6: 77,605,182 N352I probably damaging Het
Cyp2c69 A C 19: 39,886,661 L16R probably damaging Het
Dysf T C 6: 84,099,461 S603P probably damaging Het
Epha5 A G 5: 84,067,358 probably null Het
Ercc3 T C 18: 32,245,902 S270P probably damaging Het
F10 T A 8: 13,048,249 C151S probably damaging Het
Gpr180 T G 14: 118,160,046 H317Q possibly damaging Het
Gstp2 T C 19: 4,041,633 E32G possibly damaging Het
Ikzf5 T C 7: 131,392,500 T133A possibly damaging Het
Itch G T 2: 155,182,298 G274* probably null Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Lama3 T A 18: 12,561,701 S1295T possibly damaging Het
Lipc A G 9: 70,812,705 L255P probably damaging Het
Lrrc38 A G 4: 143,350,758 D197G probably benign Het
Mfap2 A G 4: 141,014,185 probably benign Het
Mfhas1 A G 8: 35,589,048 K226E probably damaging Het
Morc1 A G 16: 48,565,657 R548G probably benign Het
Mrgprb5 T C 7: 48,168,885 N34S probably benign Het
Mroh4 T C 15: 74,625,427 T182A probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo5a T C 9: 75,167,037 F743L possibly damaging Het
Notch4 A C 17: 34,583,433 D1276A probably damaging Het
Olfr139 A G 11: 74,045,047 C76R possibly damaging Het
Olfr215 T A 6: 116,582,656 I97L probably benign Het
Olfr394 A T 11: 73,888,017 Y118* probably null Het
Olfr799 T A 10: 129,647,349 C74S probably damaging Het
Plin4 T A 17: 56,106,567 T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 T827A probably benign Het
Prlr C T 15: 10,317,566 T40I probably damaging Het
Psme3 T C 11: 101,319,904 probably benign Het
Pygb A T 2: 150,815,706 D363V probably benign Het
Rsph6a C T 7: 19,054,946 Q68* probably null Het
Serpini2 A G 3: 75,258,138 V178A probably benign Het
Sh2d2a T C 3: 87,851,888 probably benign Het
Skint7 A C 4: 111,980,198 M58L probably benign Het
Slco3a1 G T 7: 74,320,553 Y435* probably null Het
Stk17b T C 1: 53,762,583 probably benign Het
Ttc21a T A 9: 119,958,799 L811Q probably damaging Het
Ttc41 A T 10: 86,759,097 M912L probably benign Het
Vmn2r98 G T 17: 19,053,613 V41F probably benign Het
Washc5 C T 15: 59,342,093 C838Y possibly damaging Het
Wrnip1 A G 13: 32,806,813 T352A probably damaging Het
Zan A C 5: 137,396,177 C4467G unknown Het
Zc3h7a T C 16: 11,152,333 probably benign Het
Zfp729a C A 13: 67,620,226 C628F probably benign Het
Other mutations in Tinag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Tinag APN 9 77045576 missense possibly damaging 0.93
IGL01524:Tinag APN 9 77045538 missense probably damaging 1.00
IGL01537:Tinag APN 9 77045603 missense probably benign 0.01
IGL01832:Tinag APN 9 77031756 missense probably benign 0.18
IGL02512:Tinag APN 9 77031787 splice site probably benign
IGL02888:Tinag APN 9 77031713 missense probably benign 0.24
G1citation:Tinag UTSW 9 77031702 missense probably benign 0.00
R0179:Tinag UTSW 9 76996882 splice site probably benign
R0200:Tinag UTSW 9 76951935 missense probably damaging 1.00
R0206:Tinag UTSW 9 76999852 missense probably damaging 1.00
R0666:Tinag UTSW 9 77005687 missense probably benign 0.02
R0685:Tinag UTSW 9 76952003 missense probably damaging 1.00
R0732:Tinag UTSW 9 77001654 missense possibly damaging 0.93
R1445:Tinag UTSW 9 77045516 missense probably damaging 1.00
R2318:Tinag UTSW 9 77045411 missense probably damaging 1.00
R3809:Tinag UTSW 9 76951905 missense probably benign 0.15
R4747:Tinag UTSW 9 76996956 missense probably benign
R4781:Tinag UTSW 9 76996950 missense possibly damaging 0.69
R5110:Tinag UTSW 9 76952007 missense probably damaging 1.00
R5328:Tinag UTSW 9 77005631 nonsense probably null
R5605:Tinag UTSW 9 77045412 missense probably damaging 1.00
R5897:Tinag UTSW 9 77045444 missense probably damaging 1.00
R6296:Tinag UTSW 9 76996935 missense possibly damaging 0.67
R6822:Tinag UTSW 9 77031702 missense probably benign 0.00
R6915:Tinag UTSW 9 77001615 missense probably damaging 1.00
R7285:Tinag UTSW 9 77045661 missense probably benign
R7334:Tinag UTSW 9 77001649 missense probably damaging 1.00
R7974:Tinag UTSW 9 76999849 missense probably benign 0.01
R8354:Tinag UTSW 9 77031695 missense probably damaging 1.00
R8454:Tinag UTSW 9 77031695 missense probably damaging 1.00
Z1177:Tinag UTSW 9 77045498 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTTGGTTCAGGCAACAACAG -3'
(R):5'- GCACATTGAGCAGCGTGTAATACAG -3'

Sequencing Primer
(F):5'- GCAAGGGAAGATTCATTCACTC -3'
(R):5'- AGCAGCGTGTAATACAGGTTTTATG -3'
Posted On2013-06-11