Incidental Mutation 'R5814:9130409I23Rik'
ID447664
Institutional Source Beutler Lab
Gene Symbol 9130409I23Rik
Ensembl Gene ENSMUSG00000038768
Gene NameRIKEN cDNA 9130409I23 gene
Synonyms
MMRRC Submission 043396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5814 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location181051237-181060667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 181055098 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 142 (V142I)
Ref Sequence ENSEMBL: ENSMUSP00000042889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036819]
Predicted Effect probably damaging
Transcript: ENSMUST00000036819
AA Change: V142I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042889
Gene: ENSMUSG00000038768
AA Change: V142I

DomainStartEndE-ValueType
Lipid_DES 5 43 6.12e-15 SMART
Pfam:FA_desaturase 64 295 7.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195319
Meta Mutation Damage Score 0.1310 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 91% (52/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,082 D135G probably benign Het
Arrdc3 G T 13: 80,890,579 R220L possibly damaging Het
Bace1 A G 9: 45,860,264 D458G probably damaging Het
Cacna1s A G 1: 136,107,142 Y1360C probably benign Het
Ccnb1-ps T C 7: 42,107,098 noncoding transcript Het
Cd209b T C 8: 3,923,348 E112G probably damaging Het
Cit T A 5: 115,979,419 L1176Q probably damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Clvs2 G T 10: 33,528,507 Q238K probably benign Het
Creb3l3 C T 10: 81,085,662 V350M probably benign Het
Crot A C 5: 8,973,996 D373E probably damaging Het
Cyp4a12b T A 4: 115,432,497 I187N probably damaging Het
Dnhd1 C A 7: 105,719,895 A4291D possibly damaging Het
Dnmt3b A T 2: 153,672,497 E403D probably benign Het
Ect2l A T 10: 18,200,009 I43K probably damaging Het
Ep400 C A 5: 110,695,578 probably null Het
Erp27 A T 6: 136,911,566 V138E possibly damaging Het
Gbp4 G A 5: 105,119,919 A487V probably benign Het
Gm10142 C A 10: 77,716,123 T106N probably damaging Het
Gm11639 T A 11: 104,736,114 probably benign Het
Gxylt2 C A 6: 100,733,235 H112Q probably damaging Het
Hexim2 G A 11: 103,138,383 R87Q probably damaging Het
Hgf A G 5: 16,602,307 N399S probably benign Het
Ikbke T A 1: 131,271,779 I302F probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kdm1b A G 13: 47,063,146 probably null Het
Krtap19-9a T C 16: 88,924,114 noncoding transcript Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mmp10 G A 9: 7,503,620 A164T possibly damaging Het
Myrip G A 9: 120,424,668 G269D probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Paxbp1 G T 16: 91,030,496 R420S probably damaging Het
Pcbp2 T A 15: 102,483,162 S38R probably damaging Het
Pcf11 A G 7: 92,657,714 V1082A probably benign Het
Pkhd1 T C 1: 20,199,405 E3305G probably damaging Het
Pla2g4c T A 7: 13,340,618 W250R probably damaging Het
Prune2 A G 19: 17,016,361 probably null Het
Rpsa A G 9: 120,128,485 probably benign Het
Sema3e A G 5: 14,225,666 I262V probably benign Het
Setd2 T A 9: 110,567,758 L1663* probably null Het
Sh3d19 G A 3: 86,126,604 V755I probably benign Het
Smim4 A G 14: 31,124,520 probably null Het
Spag9 T A 11: 94,082,828 V14E possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sspo A T 6: 48,451,884 Q411L probably damaging Het
Sycp1 A C 3: 102,895,897 S532R probably benign Het
Taf6l C A 19: 8,774,846 A493S probably benign Het
Tsnaxip1 A G 8: 105,843,971 D574G probably benign Het
Ttll10 T A 4: 156,047,627 K117N possibly damaging Het
Utp4 T A 8: 106,912,275 I405K probably damaging Het
Vmn2r45 T A 7: 8,471,476 Y851F probably benign Het
Vps33a T C 5: 123,565,056 D168G probably damaging Het
Other mutations in 9130409I23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02552:9130409I23Rik APN 1 181054898 missense possibly damaging 0.82
IGL03345:9130409I23Rik APN 1 181055372 missense probably benign 0.43
R0014:9130409I23Rik UTSW 1 181055131 missense possibly damaging 0.95
R0014:9130409I23Rik UTSW 1 181055131 missense possibly damaging 0.95
R0522:9130409I23Rik UTSW 1 181059747 missense probably damaging 0.98
R0737:9130409I23Rik UTSW 1 181055379 missense probably benign 0.15
R1710:9130409I23Rik UTSW 1 181051319 start codon destroyed probably null 0.98
R1809:9130409I23Rik UTSW 1 181059687 missense probably damaging 0.98
R2029:9130409I23Rik UTSW 1 181054931 missense probably benign 0.04
R7445:9130409I23Rik UTSW 1 181055012 missense possibly damaging 0.92
R8139:9130409I23Rik UTSW 1 181054793 missense probably damaging 0.98
Z1177:9130409I23Rik UTSW 1 181055417 missense probably damaging 1.00
Z1177:9130409I23Rik UTSW 1 181059771 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTTGGAGTGGAAATGGGTC -3'
(R):5'- GTAGACTAAGGATTTAACCCCAAAGAC -3'

Sequencing Primer
(F):5'- AAATGGGTCATATTTTGTGCCTATG -3'
(R):5'- GTCAAAGGTGATCTGAACAAC -3'
Posted On2016-12-15