Mutagenetix > Incidental Mutation

Incidental Mutation 'R0545:Cacna2d2'

44767

Institutional Source

Beutler Lab

Gene Symbol

Cacna2d2

Ensembl Gene

ENSMUSG00000010066

Gene Name

calcium channel, voltage-dependent, alpha 2/delta subunit 2

Synonyms

a2d2

MMRRC Submission

038737-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.889) question?

Stock #

R0545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107399612-107529343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107525223 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 826 (L826P)

Ref Sequence

ENSEMBL: ENSMUSP00000125943 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010210] [ENSMUST00000085092] [ENSMUST00000164988] [ENSMUST00000166799] [ENSMUST00000168532] [ENSMUST00000170737]

AlphaFold

Q6PHS9

Predicted Effect

probably damaging
Transcript: ENSMUST00000010210
AA Change: L826P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066
AA Change: L826P

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	9.9e-32	PFAM
Pfam:VGCC_alpha2	583	673	1.8e-33	PFAM
low complexity region	968	977	N/A	INTRINSIC
low complexity region	1114	1137	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000085092
AA Change: L833P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066
AA Change: L833P

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	676	5.8e-35	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1120	1143	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164988
AA Change: L832P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066
AA Change: L832P

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	6.7e-49	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	2.4e-31	PFAM
Pfam:VGCC_alpha2	583	675	2.5e-34	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166799
AA Change: L833P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066
AA Change: L833P

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	8.5e-44	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	576	1.3e-32	PFAM
Pfam:VGCC_alpha2	583	675	1.4e-47	PFAM
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168532
AA Change: L833P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066
AA Change: L833P

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2.1e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	676	5.8e-35	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1122	1145	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168959

Predicted Effect

probably damaging
Transcript: ENSMUST00000170737
AA Change: L826P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066
AA Change: L826P

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	673	1.9e-33	PFAM
low complexity region	968	977	N/A	INTRINSIC
low complexity region	1116	1139	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194842

Meta Mutation Damage Score

0.5920

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.9%
20x: 94.0%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	C	T	2: 19,542,376	R76H	probably damaging	Het
4932438A13Rik	G	A	3: 36,987,690		probably benign	Het
Adnp2	T	C	18: 80,129,401	I598V	probably benign	Het
Ago3	T	C	4: 126,417,232	N63D	probably damaging	Het
Alkbh7	C	T	17: 56,999,012	R138*	probably null	Het
Atp6ap1l	T	C	13: 90,883,663	H300R	probably benign	Het
BC051076	C	T	5: 87,963,490		noncoding transcript	Het
Bpifb9a	T	A	2: 154,261,950	C104*	probably null	Het
Car5b	G	A	X: 163,979,301	R282C	probably damaging	Het
Ccdc88c	T	C	12: 100,947,188	D526G	probably damaging	Het
Cdh23	T	A	10: 60,331,291	T1861S	probably benign	Het
Ces2f	A	C	8: 104,950,036	M121L	possibly damaging	Het
Cfap58	G	A	19: 47,941,097		probably benign	Het
Chpf2	T	C	5: 24,590,324	S282P	possibly damaging	Het
Cluap1	C	T	16: 3,933,772	R332W	probably damaging	Het
Cma2	A	T	14: 55,973,113	M86L	probably benign	Het
Cog6	A	T	3: 52,996,075	M134K	probably damaging	Het
Col1a1	A	G	11: 94,951,594	D1446G	unknown	Het
Cpne8	T	A	15: 90,497,075	D512V	probably damaging	Het
Ctnna2	T	A	6: 77,605,182	N352I	probably damaging	Het
Cyp2c69	A	C	19: 39,886,661	L16R	probably damaging	Het
Dysf	T	C	6: 84,099,461	S603P	probably damaging	Het
Epha5	A	G	5: 84,067,358		probably null	Het
Ercc3	T	C	18: 32,245,902	S270P	probably damaging	Het
F10	T	A	8: 13,048,249	C151S	probably damaging	Het
Gpr180	T	G	14: 118,160,046	H317Q	possibly damaging	Het
Gstp2	T	C	19: 4,041,633	E32G	possibly damaging	Het
Ikzf5	T	C	7: 131,392,500	T133A	possibly damaging	Het
Itch	G	T	2: 155,182,298	G274*	probably null	Het
Jarid2	T	A	13: 44,902,831	N365K	probably benign	Het
Lama3	T	A	18: 12,561,701	S1295T	possibly damaging	Het
Lipc	A	G	9: 70,812,705	L255P	probably damaging	Het
Lrrc38	A	G	4: 143,350,758	D197G	probably benign	Het
Mfap2	A	G	4: 141,014,185		probably benign	Het
Mfhas1	A	G	8: 35,589,048	K226E	probably damaging	Het
Morc1	A	G	16: 48,565,657	R548G	probably benign	Het
Mrgprb5	T	C	7: 48,168,885	N34S	probably benign	Het
Mroh4	T	C	15: 74,625,427	T182A	probably benign	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Myo5a	T	C	9: 75,167,037	F743L	possibly damaging	Het
Notch4	A	C	17: 34,583,433	D1276A	probably damaging	Het
Olfr139	A	G	11: 74,045,047	C76R	possibly damaging	Het
Olfr215	T	A	6: 116,582,656	I97L	probably benign	Het
Olfr394	A	T	11: 73,888,017	Y118*	probably null	Het
Olfr799	T	A	10: 129,647,349	C74S	probably damaging	Het
Plin4	T	A	17: 56,106,567	T353S	probably damaging	Het
Ppp1r9a	A	G	6: 5,115,357	T827A	probably benign	Het
Prlr	C	T	15: 10,317,566	T40I	probably damaging	Het
Psme3	T	C	11: 101,319,904		probably benign	Het
Pygb	A	T	2: 150,815,706	D363V	probably benign	Het
Rsph6a	C	T	7: 19,054,946	Q68*	probably null	Het
Serpini2	A	G	3: 75,258,138	V178A	probably benign	Het
Sh2d2a	T	C	3: 87,851,888		probably benign	Het
Skint7	A	C	4: 111,980,198	M58L	probably benign	Het
Slco3a1	G	T	7: 74,320,553	Y435*	probably null	Het
Stk17b	T	C	1: 53,762,583		probably benign	Het
Tinag	T	A	9: 77,031,710	H162L	possibly damaging	Het
Ttc21a	T	A	9: 119,958,799	L811Q	probably damaging	Het
Ttc41	A	T	10: 86,759,097	M912L	probably benign	Het
Vmn2r98	G	T	17: 19,053,613	V41F	probably benign	Het
Washc5	C	T	15: 59,342,093	C838Y	possibly damaging	Het
Wrnip1	A	G	13: 32,806,813	T352A	probably damaging	Het
Zan	A	C	5: 137,396,177	C4467G	unknown	Het
Zc3h7a	T	C	16: 11,152,333		probably benign	Het
Zfp729a	C	A	13: 67,620,226	C628F	probably benign	Het

Other mutations in Cacna2d2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Cacna2d2	APN	9	107514873	missense	probably damaging	1.00
IGL00425:Cacna2d2	APN	9	107527351	missense	probably damaging	1.00
IGL01294:Cacna2d2	APN	9	107514081	missense	probably damaging	1.00
IGL01969:Cacna2d2	APN	9	107509216	missense	probably benign
IGL01974:Cacna2d2	APN	9	107517422	missense	probably benign	0.00
IGL02001:Cacna2d2	APN	9	107522116	missense	probably benign
IGL02125:Cacna2d2	APN	9	107513904	nonsense	probably null
IGL02143:Cacna2d2	APN	9	107518275	splice site	probably null
IGL02150:Cacna2d2	APN	9	107527316	splice site	probably benign
IGL02213:Cacna2d2	APN	9	107514048	missense	probably damaging	1.00
IGL02220:Cacna2d2	APN	9	107514879	missense	probably damaging	1.00
IGL02238:Cacna2d2	APN	9	107513558	missense	probably damaging	0.99
IGL02466:Cacna2d2	APN	9	107465554	missense	probably damaging	1.00
IGL02569:Cacna2d2	APN	9	107514046	missense	probably damaging	0.99
IGL02571:Cacna2d2	APN	9	107525646	missense	possibly damaging	0.93
IGL02825:Cacna2d2	APN	9	107524460	missense	probably damaging	1.00
IGL03000:Cacna2d2	APN	9	107524198	splice site	probably null
IGL03064:Cacna2d2	APN	9	107509275	missense	probably damaging	1.00
Blow	UTSW	9	107513606	missense	probably null	0.90
dilemma	UTSW	9	107514864	missense	probably damaging	1.00
hera	UTSW	9	107513280	missense	probably damaging	1.00
Ionian	UTSW	9	107525376	missense	probably benign	0.05
Solomonic	UTSW	9	107524662	missense	possibly damaging	0.94
PIT4131001:Cacna2d2	UTSW	9	107524668	missense	probably damaging	1.00
R0233:Cacna2d2	UTSW	9	107514670	missense	probably damaging	0.96
R0233:Cacna2d2	UTSW	9	107514670	missense	probably damaging	0.96
R0387:Cacna2d2	UTSW	9	107513881	missense	probably damaging	1.00
R0410:Cacna2d2	UTSW	9	107524620	missense	probably damaging	1.00
R0538:Cacna2d2	UTSW	9	107524383	splice site	probably benign
R0729:Cacna2d2	UTSW	9	107517257	missense	probably benign	0.06
R1024:Cacna2d2	UTSW	9	107527050	critical splice donor site	probably null
R1538:Cacna2d2	UTSW	9	107517416	missense	probably damaging	1.00
R1750:Cacna2d2	UTSW	9	107524644	missense	probably damaging	1.00
R1774:Cacna2d2	UTSW	9	107526151	missense	probably benign	0.19
R1800:Cacna2d2	UTSW	9	107527433	missense	possibly damaging	0.46
R1873:Cacna2d2	UTSW	9	107513872	missense	probably damaging	0.98
R1935:Cacna2d2	UTSW	9	107509256	missense	probably damaging	1.00
R1936:Cacna2d2	UTSW	9	107509256	missense	probably damaging	1.00
R1971:Cacna2d2	UTSW	9	107512006	missense	probably damaging	0.98
R2095:Cacna2d2	UTSW	9	107527165	missense	probably benign	0.05
R2135:Cacna2d2	UTSW	9	107526513	missense	possibly damaging	0.74
R2197:Cacna2d2	UTSW	9	107527403	missense	probably damaging	0.97
R2266:Cacna2d2	UTSW	9	107513280	missense	probably damaging	1.00
R2483:Cacna2d2	UTSW	9	107512022	missense	probably damaging	1.00
R4021:Cacna2d2	UTSW	9	107514058	missense	probably damaging	1.00
R4392:Cacna2d2	UTSW	9	107400280	missense	possibly damaging	0.47
R4629:Cacna2d2	UTSW	9	107527322	missense	probably damaging	1.00
R5053:Cacna2d2	UTSW	9	107514864	missense	probably damaging	1.00
R5327:Cacna2d2	UTSW	9	107513606	missense	probably null	0.90
R5347:Cacna2d2	UTSW	9	107514114	missense	probably benign
R5719:Cacna2d2	UTSW	9	107524652	missense	probably benign	0.36
R5737:Cacna2d2	UTSW	9	107526747	missense	possibly damaging	0.70
R5739:Cacna2d2	UTSW	9	107512329	missense	probably benign	0.37
R6037:Cacna2d2	UTSW	9	107513539	missense	probably damaging	1.00
R6037:Cacna2d2	UTSW	9	107513539	missense	probably damaging	1.00
R6084:Cacna2d2	UTSW	9	107497521	critical splice donor site	probably null
R6170:Cacna2d2	UTSW	9	107527334	missense	probably damaging	1.00
R6254:Cacna2d2	UTSW	9	107509216	missense	probably benign
R6427:Cacna2d2	UTSW	9	107515442	missense	possibly damaging	0.67
R7652:Cacna2d2	UTSW	9	107524198	splice site	probably null
R7850:Cacna2d2	UTSW	9	107525376	missense	probably benign	0.05
R7936:Cacna2d2	UTSW	9	107524127	missense	probably damaging	1.00
R7978:Cacna2d2	UTSW	9	107518257	missense	probably benign	0.14
R8039:Cacna2d2	UTSW	9	107527433	missense	possibly damaging	0.92
R8165:Cacna2d2	UTSW	9	107525454	splice site	probably null
R8274:Cacna2d2	UTSW	9	107524662	missense	possibly damaging	0.94
R8286:Cacna2d2	UTSW	9	107514864	missense	probably damaging	1.00
R8354:Cacna2d2	UTSW	9	107524135	missense	possibly damaging	0.95
R8464:Cacna2d2	UTSW	9	107512007	missense	probably damaging	0.99
R8479:Cacna2d2	UTSW	9	107526397	critical splice donor site	probably null
R8765:Cacna2d2	UTSW	9	107517159	missense	probably damaging	1.00
R8848:Cacna2d2	UTSW	9	107514656	missense	possibly damaging	0.75
R9037:Cacna2d2	UTSW	9	107509196	missense	probably benign	0.08
R9225:Cacna2d2	UTSW	9	107526204	missense	probably benign	0.10
R9295:Cacna2d2	UTSW	9	107509220	missense	probably benign	0.02
R9372:Cacna2d2	UTSW	9	107517603	missense	probably benign	0.00
R9414:Cacna2d2	UTSW	9	107515196	missense	probably damaging	1.00
R9417:Cacna2d2	UTSW	9	107515490	nonsense	probably null
R9435:Cacna2d2	UTSW	9	107519185	missense	probably benign	0.01
R9584:Cacna2d2	UTSW	9	107400205	missense	probably damaging	0.97
R9642:Cacna2d2	UTSW	9	107515428	missense	possibly damaging	0.94
R9784:Cacna2d2	UTSW	9	107527147	missense	probably benign	0.00
Z1176:Cacna2d2	UTSW	9	107517293	missense	probably damaging	1.00
Z1176:Cacna2d2	UTSW	9	107526102	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TGTGAGTGTCTGTCCATACCCAGC -3'
(R):5'- ACCTTGAACTTTTCAGCCCAAGCC -3'

Sequencing Primer
(F):5'- CCAGACACTGTATGAGGTGC -3'
(R):5'- AAGCCTCTAGGTCCAGTTTGAC -3'

Posted On

2013-06-11